Regulon of SmoR in Paracoccus denitrificans PD1222

Properties
Regulator type:	Transcription factor
TF locus tag:	Pden_4846
Regulator family:	LacI
Regulation mode:
Biological process:	Sorbitol utilization; Mannitol utilization
Effector:	Sorbitol
Regulog:	SmoR - Rhodobacterales
Statistics of regulated genes:
- Genes	12
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By effector - Sorbitol
By pathway - Sorbitol utilization
By pathway - Mannitol utilization

Regulated operons
	Locus Tag	Name	Function
Position: -54 Score: 4.6 Sequence: GTCTTTACGCGAGACAATAT Locus tag: Pden_4846 Name: smoR Funciton: Transcriptional regulator for sorbitol and mannitol utilization, LacI family
	Pden_4846	smoR	Transcriptional regulator for sorbitol and mannitol utilization, LacI family
Position: -122 Score: 5.4 Sequence: AATTTGACACGCGTAAAATA Locus tag: Pden_4851 Name: Pden_4851 Funciton: Putative sugar polyol ABC transporter, substrate-binding component Locus tag: Pden_4850 Name: Pden_4850 Funciton: Putative sugar polyol ABC transporter, ATP-binding protein Locus tag: Pden_4849 Name: Pden_4849 Funciton: Putative sugar polyol ABC transporter, permease components Locus tag: Pden_4848 Name: scrK Funciton: Fructokinase (EC 2.7.1.4) Locus tag: Pden_4847 Name: pfkZ Funciton: 6-phosphofructokinase (EC 2.7.1.11), PF08013 family
	Pden_4851	Pden_4851	Putative sugar polyol ABC transporter, substrate-binding component
	Pden_4850	Pden_4850	Putative sugar polyol ABC transporter, ATP-binding protein
	Pden_4849	Pden_4849	Putative sugar polyol ABC transporter, permease components
	Pden_4848	scrK	Fructokinase (EC 2.7.1.4)
	Pden_4847	pfkZ	6-phosphofructokinase (EC 2.7.1.11), PF08013 family
Position: -87 Score: 5.8 Sequence: AATTTTTCGCGCGTAAAAAT Locus tag: Pden_4845 Name: smoE Funciton: Various polyols ABC transporter, substrate-binding protein Locus tag: Pden_4844 Name: smoF Funciton: Various polyols ABC transporter, inner membrane component 1 Locus tag: Pden_4843 Name: smoG Funciton: ABC sorbitol/mannitol transporter, inner membrane component 2 Locus tag: Pden_4842 Name: smoK Funciton: Various polyols ABC transporter, ATP-binding component Locus tag: Pden_4841 Name: smoS Funciton: Sorbitol dehydrogenase (EC 1.1.1.14) Locus tag: Pden_4840 Name: smoD Funciton: Putative mannitol dehydrogenase (EC 1.1.1.67), similar to arabinitol dehydrogenase
	Pden_4845	smoE	Various polyols ABC transporter, substrate-binding protein
	Pden_4844	smoF	Various polyols ABC transporter, inner membrane component 1
	Pden_4843	smoG	ABC sorbitol/mannitol transporter, inner membrane component 2
	Pden_4842	smoK	Various polyols ABC transporter, ATP-binding component
	Pden_4841	smoS	Sorbitol dehydrogenase (EC 1.1.1.14)
	Pden_4840	smoD	Putative mannitol dehydrogenase (EC 1.1.1.67), similar to arabinitol dehydrogenase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD