Regulon of SmoR in Sulfitobacter sp. EE-36

Properties
Regulator type:	Transcription factor
TF locus tag:	EE36_14657
Regulator family:	LacI
Regulation mode:
Biological process:	Sorbitol utilization; Mannitol utilization
Effector:	Sorbitol
Regulog:	SmoR - Rhodobacterales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By effector - Sorbitol
By pathway - Sorbitol utilization
By pathway - Mannitol utilization

Regulated operons
	Locus Tag	Name	Function
Position: -85 Score: 5.8 Sequence: AACTAGACGCGCGTAAAATT Locus tag: EE36_14652 Name: smoE Funciton: Various polyols ABC transporter, substrate-binding protein Locus tag: EE36_14647 Name: smoF Funciton: Various polyols ABC transporter, inner membrane component 1 Locus tag: EE36_14642 Name: smoG Funciton: ABC sorbitol/mannitol transporter, inner membrane component 2 Locus tag: EE36_14637 Name: smoK Funciton: Various polyols ABC transporter, ATP-binding component Locus tag: EE36_14632 Name: mtlK Funciton: Mannitol dehydrogenase (EC 1.1.1.67) Locus tag: EE36_14627 Name: mtlZ Funciton: Fructokinase (EC 2.7.1.4)
	EE36_14652	smoE	Various polyols ABC transporter, substrate-binding protein
	EE36_14647	smoF	Various polyols ABC transporter, inner membrane component 1
	EE36_14642	smoG	ABC sorbitol/mannitol transporter, inner membrane component 2
	EE36_14637	smoK	Various polyols ABC transporter, ATP-binding component
	EE36_14632	mtlK	Mannitol dehydrogenase (EC 1.1.1.67)
	EE36_14627	mtlZ	Fructokinase (EC 2.7.1.4)
Position: -89 Score: 4.3 Sequence: TATTTACCGCGCGACAAGTA Locus tag: EE36_14657 Name: smoR Funciton: Transcriptional regulator for sorbitol and mannitol utilization, LacI family
	EE36_14657	smoR	Transcriptional regulator for sorbitol and mannitol utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD