Regulon of SmoR in Loktanella vestfoldensis SKA53

Properties
Regulator type:	Transcription factor
TF locus tag:	SKA53_11074
Regulator family:	LacI
Regulation mode:
Biological process:	Sorbitol utilization; Mannitol utilization
Effector:	Sorbitol
Regulog:	SmoR - Rhodobacterales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By effector - Sorbitol
By pathway - Sorbitol utilization
By pathway - Mannitol utilization

Regulated operons
	Locus Tag	Name	Function
Position: -77 Score: 5.2 Sequence: CTGTTAACGCGCGTAAATTT Locus tag: SKA53_11074 Name: smoR Funciton: Transcriptional regulator for sorbitol and mannitol utilization, LacI family
	SKA53_11074	smoR	Transcriptional regulator for sorbitol and mannitol utilization, LacI family
Position: -93 Score: 5.3 Sequence: TATTTTACGCGCGTAAAATC Locus tag: SKA53_11098 Name: smoE Funciton: Various polyols ABC transporter, substrate-binding protein
	SKA53_11098	smoE	Various polyols ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD