Regulon of SmoR in Silicibacter TM1040

Properties
Regulator type:	Transcription factor
TF locus tag:	TM1040_0432
Regulator family:	LacI
Regulation mode:
Biological process:	Sorbitol utilization; Mannitol utilization
Effector:	Sorbitol
Regulog:	SmoR - Rhodobacterales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By effector - Sorbitol
By pathway - Sorbitol utilization
By pathway - Mannitol utilization

Regulated operons
	Locus Tag	Name	Function
Position: -93 Score: 5.1 Sequence: AAGTTTGCGCCCGCAAAGTT Locus tag: TM1040_0432 Name: smoR Funciton: Transcriptional regulator for sorbitol and mannitol utilization, LacI family
	TM1040_0432	smoR	Transcriptional regulator for sorbitol and mannitol utilization, LacI family
Position: -89 Score: 5.8 Sequence: TTCTTTACGCGCGTAAATTT Locus tag: TM1040_0431 Name: smoE Funciton: Various polyols ABC transporter, substrate-binding protein Locus tag: TM1040_0430 Name: smoF Funciton: Various polyols ABC transporter, inner membrane component 1 Locus tag: TM1040_0429 Name: smoG Funciton: ABC sorbitol/mannitol transporter, inner membrane component 2 Locus tag: TM1040_0428 Name: smoK Funciton: Various polyols ABC transporter, ATP-binding component Locus tag: TM1040_0427 Name: smoS Funciton: Sorbitol dehydrogenase (EC 1.1.1.14) Locus tag: TM1040_0426 Name: mtlK Funciton: Mannitol dehydrogenase (EC 1.1.1.67)
	TM1040_0431	smoE	Various polyols ABC transporter, substrate-binding protein
	TM1040_0430	smoF	Various polyols ABC transporter, inner membrane component 1
	TM1040_0429	smoG	ABC sorbitol/mannitol transporter, inner membrane component 2
	TM1040_0428	smoK	Various polyols ABC transporter, ATP-binding component
	TM1040_0427	smoS	Sorbitol dehydrogenase (EC 1.1.1.14)
	TM1040_0426	mtlK	Mannitol dehydrogenase (EC 1.1.1.67)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD