Orthologous regulated operons containing pfkZ gene

Properties
Regulog:	SmoR - Rhodobacterales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:
Biological process:	Sorbitol utilization; Mannitol utilization
Effector:	Sorbitol
Phylum:	Proteobacteria/Alpha

Built upon 15 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Paracoccus denitrificans PD1222
Position: -122 Score: 5.44952 Sequence: AATTTGACACGCGTAAAATA Locus tag: Pden_4851 Name: Pden_4851 Funciton: Putative sugar polyol ABC transporter, substrate-binding component Locus tag: Pden_4850 Name: Pden_4850 Funciton: Putative sugar polyol ABC transporter, ATP-binding protein Locus tag: Pden_4849 Name: Pden_4849 Funciton: Putative sugar polyol ABC transporter, permease components Locus tag: Pden_4848 Name: scrK Funciton: Fructokinase (EC 2.7.1.4) Locus tag: Pden_4847 Name: pfkZ Funciton: 6-phosphofructokinase (EC 2.7.1.11), PF08013 family
Pden_4851-Pden_4850-Pden_4849-scrK-pfkZ	-122	5.4	AATTTGACACGCGTAAAATA	Pden_4851

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --