Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing mtlK gene

Properties
Regulog: SmoR - Rhodobacterales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Sorbitol utilization; Mannitol utilization
Effector: Sorbitol
Phylum: Proteobacteria/Alpha
Built upon 15 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -89
Score: 6.40309
Sequence: AAATTTACGCGCGTAAAGTT
Locus tag: Jann_2902
Name: smoE
Funciton: Various polyols ABC transporter, substrate-binding protein
Locus tag: Jann_2903
Name: smoF
Funciton: Various polyols ABC transporter, inner membrane component 1
Locus tag: Jann_2904
Name: smoG
Funciton: ABC sorbitol/mannitol transporter, inner membrane component 2
Locus tag: Jann_2905
Name: smoK
Funciton: Various polyols ABC transporter, ATP-binding component
Locus tag: Jann_2906
Name: smoS
Funciton: Sorbitol dehydrogenase (EC 1.1.1.14)
Locus tag: Jann_2907
Name: mtlK
Funciton: Mannitol dehydrogenase (EC 1.1.1.67)
smoE-smoF-smoG-smoK-smoS-mtlK -89 6.4 AAATTTACGCGCGTAAAGTT Jann_2902
Oceanicola batsensis HTCC2597
Position: -104
Score: 5.54523
Sequence: TTCTTTACGCGCGTCAAATT
Locus tag: OB2597_06125
Name: smoE
Funciton: Various polyols ABC transporter, substrate-binding protein
Locus tag: OB2597_06130
Name: smoE
Funciton: Various polyols ABC transporter, substrate-binding protein
Locus tag: OB2597_06135
Name: smoF
Funciton: Various polyols ABC transporter, inner membrane component 1
Locus tag: OB2597_06140
Name: smoG
Funciton: ABC sorbitol/mannitol transporter, inner membrane component 2
Locus tag: OB2597_06145
Name: smoK
Funciton: Various polyols ABC transporter, ATP-binding component
Locus tag: OB2597_06150
Name: smoS
Funciton: Sorbitol dehydrogenase (EC 1.1.1.14)
Locus tag: OB2597_06155
Name: mtlK
Funciton: Mannitol dehydrogenase (EC 1.1.1.67)
Locus tag: OB2597_06160
Name: mtlZ
Funciton: Fructokinase (EC 2.7.1.4)
smoE-smoE-smoF-smoG-smoK-smoS-mtlK-mtlZ -104 5.5 TTCTTTACGCGCGTCAAATT OB2597_06125
Silicibacter TM1040
Position: -89
Score: 5.80599
Sequence: TTCTTTACGCGCGTAAATTT
Locus tag: TM1040_0431
Name: smoE
Funciton: Various polyols ABC transporter, substrate-binding protein
Locus tag: TM1040_0430
Name: smoF
Funciton: Various polyols ABC transporter, inner membrane component 1
Locus tag: TM1040_0429
Name: smoG
Funciton: ABC sorbitol/mannitol transporter, inner membrane component 2
Locus tag: TM1040_0428
Name: smoK
Funciton: Various polyols ABC transporter, ATP-binding component
Locus tag: TM1040_0427
Name: smoS
Funciton: Sorbitol dehydrogenase (EC 1.1.1.14)
Locus tag: TM1040_0426
Name: mtlK
Funciton: Mannitol dehydrogenase (EC 1.1.1.67)
smoE-smoF-smoG-smoK-smoS-mtlK -89 5.8 TTCTTTACGCGCGTAAATTT TM1040_0431
Sulfitobacter sp. EE-36
Position: -85
Score: 5.76423
Sequence: AACTAGACGCGCGTAAAATT
Locus tag: EE36_14652
Name: smoE
Funciton: Various polyols ABC transporter, substrate-binding protein
Locus tag: EE36_14647
Name: smoF
Funciton: Various polyols ABC transporter, inner membrane component 1
Locus tag: EE36_14642
Name: smoG
Funciton: ABC sorbitol/mannitol transporter, inner membrane component 2
Locus tag: EE36_14637
Name: smoK
Funciton: Various polyols ABC transporter, ATP-binding component
Locus tag: EE36_14632
Name: mtlK
Funciton: Mannitol dehydrogenase (EC 1.1.1.67)
Locus tag: EE36_14627
Name: mtlZ
Funciton: Fructokinase (EC 2.7.1.4)
smoE-smoF-smoG-smoK-mtlK-mtlZ -85 5.8 AACTAGACGCGCGTAAAATT EE36_14652