Regulog NiaR - Clostridia-3
| Regulator type: | Transcription factor |
| Regulator family: | NiaR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Niacin |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Clostridia-3
- By TF family - NiaR
- By effector - Niacin
- By pathway - NAD biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Bacteroides pectinophilus ATCC 43243 | 1 | 1 |
| Blautia hansenii DSM 20583 | 2 | 1 |
| Bryantella formatexigens DSM 14469 | 1 | 1 |
| Clostridiales bacterium 1_7_47_FAA | ||
| Clostridium bolteae ATCC BAA-613 | 4 | 1 |
| Clostridium nexile DSM 1787 | 5 | 2 |
| Clostridium scindens ATCC 35704 | 5 | 2 |
| Dorea formicigenerans ATCC 27755 | 3 | 1 |
| Dorea longicatena DSM 13814 | 4 | 2 |
| Eubacterium eligens ATCC 27750 | 4 | 1 |
| Eubacterium rectale ATCC 33656 | 4 | 2 |
| Roseburia intestinalis L1-82 | 1 | 1 |
| Ruminococcus gnavus ATCC 29149 | 4 | 1 |
| Ruminococcus lactaris ATCC 29176 | 4 | 1 |
| Genes | Function | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||
| niaY |
*
Bacteroides pectinophilus ATCC 43243 Site: position = -45 score = 5.37441 sequence = ATCATCTGACAAGACAGTTGAC Site: position = -33 score = 5.30768 sequence = GACAGTTGACATTACAGCTGTA Gene: BACPEC_00421: Predicted nicotinate-regulated transporter NiaY |
Gene: BLAHAN_00635: Predicted nicotinate-regulated transporter NiaY |
*
Bryantella formatexigens DSM 14469 Site: position = -42 score = 5.62962 sequence = TGCAGGTGACAAGACACTTGAC Gene: BRYFOR_01996: Predicted nicotinate-regulated transporter NiaY |
|
|
*
Clostridium nexile DSM 1787 Site: position = -47 score = 5.84505 sequence = TGCTAGTGACAAGACACATGTA Gene: CLONEX_03876: Predicted nicotinate-regulated transporter NiaY |
*
Clostridium scindens ATCC 35704 Site: position = -53 score = 5.91121 sequence = TTCAAATGACAAGACAGTTGTA Gene: CLOSCI_02252: Predicted nicotinate-regulated transporter NiaY |
|
*
Dorea longicatena DSM 13814 Site: position = -98 score = 6.36318 sequence = GACATGTGACAAGACACATGTA Gene: DORLON_02159: Predicted nicotinate-regulated transporter NiaY |
|
|
|
|
Gene: RUMLAC_02018: Predicted nicotinate-regulated transporter NiaY |
Predicted nicotinate-regulated transporter NiaY |
| CRON 2. | |||||||||||||||
| nadA |
|
*
Blautia hansenii DSM 20583 Site: position = -256 score = 6.23992 sequence = AACAACTGTCTTGTCACTTGTA Gene: BLAHAN_02639: Quinolinate synthetase (EC 4.1.99.-) |
|
|
*
Clostridium bolteae ATCC BAA-613 Site: position = -108 score = 5.10874 sequence = CCTATATGTCTTGTCACATGTA Gene: CLOBOL_03914: Quinolinate synthetase (EC 4.1.99.-) |
*
Clostridium nexile DSM 1787 Site: position = -3 score = 6.02303 sequence = AGCATGTGTCTTGTCACCTGTA Gene: CLONEX_03264: Quinolinate synthetase (EC 4.1.99.-) |
*
Clostridium scindens ATCC 35704 Site: position = -10 score = 5.26456 sequence = CTTATCTGTCTTGTCATATGTA Gene: CLOSCI_01553: Quinolinate synthetase (EC 4.1.99.-) |
*
Dorea formicigenerans ATCC 27755 Site: position = -47 score = 4.86463 sequence = ACTTACTGTCTTGTCACATGTA Gene: DORFOR_01504: Quinolinate synthetase (EC 4.1.99.-) |
Gene: DORLON_00278: Quinolinate synthetase (EC 4.1.99.-) |
*
Eubacterium eligens ATCC 27750 Site: position = -102 score = 6.45869 sequence = TACAACTGTCTTGTCACATGTA Gene: EUBELI_01431: Quinolinate synthetase (EC 4.1.99.-) |
*
Eubacterium rectale ATCC 33656 Site: position = -173 score = 6.32847 sequence = TACAACTGACAAGACACCTGTA Gene: EUBREC_1033: Quinolinate synthetase (EC 4.1.99.-) |
*2
Roseburia intestinalis L1-82 Site: position = -69 score = 6.20911 sequence = AACATGTGTCTTGTCATATGTA Gene: ROSINTL182_03917: Quinolinate synthetase (EC 4.1.99.-) Gene: ROSINTL182_03918: Quinolinate synthetase (EC 4.1.99.-) |
*
Ruminococcus gnavus ATCC 29149 Site: position = -94 score = 6.16344 sequence = CACAACTGTCTTGTCACATGTA Gene: RUMGNA_03804: Quinolinate synthetase (EC 4.1.99.-) |
*
Ruminococcus lactaris ATCC 29176 Site: position = -57 score = 6.19748 sequence = AACATCTGTCTTGTCACCTGTA Gene: RUMLAC_00642: Quinolinate synthetase (EC 4.1.99.-) |
Quinolinate synthetase (EC 4.1.99.-) |
| nadB |
|
Gene: BLAHAN_02638: L-aspartate oxidase (EC 1.4.3.16) |
|
|
Gene: CLOBOL_03915: L-aspartate oxidase (EC 1.4.3.16) |
Gene: CLONEX_03263: L-aspartate oxidase (EC 1.4.3.16) |
Gene: CLOSCI_01552: L-aspartate oxidase (EC 1.4.3.16) |
Gene: DORFOR_01505: L-aspartate oxidase (EC 1.4.3.16) |
*
Dorea longicatena DSM 13814 Site: position = -123 score = 6.11465 sequence = AACAATTGTCTTGTCACATGTA Gene: DORLON_01089: L-aspartate oxidase (EC 1.4.3.16) |
Gene: EUBELI_01430: L-aspartate oxidase (EC 1.4.3.16) |
*
Eubacterium rectale ATCC 33656 Site: position = -129 score = 6.32847 sequence = TACAGGTGTCTTGTCAGTTGTA Gene: EUBREC_1034: L-aspartate oxidase (EC 1.4.3.16) |
Gene: ROSINTL182_03919: L-aspartate oxidase (EC 1.4.3.16) |
Gene: RUMGNA_03805: L-aspartate oxidase (EC 1.4.3.16) |
Gene: RUMLAC_00641: L-aspartate oxidase (EC 1.4.3.16) |
L-aspartate oxidase (EC 1.4.3.16) |
| nadC |
|
Gene: BLAHAN_02635: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
|
|
Gene: CLOBOL_03916: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Gene: CLONEX_03262: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Gene: CLOSCI_01551: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Gene: DORFOR_01506: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Gene: DORLON_01088: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Gene: EUBELI_01429: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Gene: EUBREC_1035: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Gene: ROSINTL182_03920: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Gene: RUMGNA_03806: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Gene: RUMLAC_00640: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
| niaR |
Gene: BACPEC_00422: NAD biosynthesis transcription regulator, HTH_11 family |
Gene: BLAHAN_02634: NAD biosynthesis transcription regulator, HTH_11 family |
Gene: BRYFOR_01997: NAD biosynthesis transcription regulator, HTH_11 family |
Gene: Cbac1_010100010440: NAD biosynthesis transcription regulator, HTH_11 family |
Gene: CLOBOL_03917: NAD biosynthesis transcription regulator, HTH_11 family |
Gene: CLONEX_03261: NAD biosynthesis transcription regulator, HTH_11 family |
Gene: CLOSCI_01550: NAD biosynthesis transcription regulator, HTH_11 family |
Gene: DORFOR_02387: NAD biosynthesis transcription regulator, HTH_11 family |
Gene: DORLON_01087: NAD biosynthesis transcription regulator, HTH_11 family |
Gene: EUBELI_01428: NAD biosynthesis transcription regulator, HTH_11 family |
Gene: EUBREC_1036: NAD biosynthesis transcription regulator, HTH_11 family |
Gene: ROSINTL182_03921: NAD biosynthesis transcription regulator, HTH_11 family |
Gene: RUMGNA_03807: NAD biosynthesis transcription regulator, HTH_11 family |
Gene: RUMLAC_00639: NAD biosynthesis transcription regulator, HTH_11 family |
NAD biosynthesis transcription regulator, HTH_11 family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |