Regulon of NiaR in Clostridium scindens ATCC 35704

Properties
Regulator type:	Transcription factor
TF locus tag:	CLOSCI_01550
Regulator family:	NiaR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Niacin
Regulog:	NiaR - Clostridia-3
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By TF family - NiaR
By effector - Niacin
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -10 Score: 5.3 Sequence: CTTATCTGTCTTGTCATATGTA Locus tag: CLOSCI_01553 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-) Locus tag: CLOSCI_01552 Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16) Locus tag: CLOSCI_01551 Name: nadC Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) Locus tag: CLOSCI_01550 Name: niaR Funciton: NAD biosynthesis transcription regulator, HTH_11 family
	CLOSCI_01553	nadA	Quinolinate synthetase (EC 4.1.99.-)
	CLOSCI_01552	nadB	L-aspartate oxidase (EC 1.4.3.16)
	CLOSCI_01551	nadC	Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
	CLOSCI_01550	niaR	NAD biosynthesis transcription regulator, HTH_11 family
Position: -53 Score: 5.9 Sequence: TTCAAATGACAAGACAGTTGTA Locus tag: CLOSCI_02252 Name: niaY Funciton: Predicted nicotinate-regulated transporter NiaY
	CLOSCI_02252	niaY	Predicted nicotinate-regulated transporter NiaY

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD