Regulon of NiaR in Dorea longicatena DSM 13814

Properties
Regulator type:	Transcription factor
TF locus tag:	DORLON_01087
Regulator family:	NiaR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Niacin
Regulog:	NiaR - Clostridia-3
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By TF family - NiaR
By effector - Niacin
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -123 Score: 6.1 Sequence: AACAATTGTCTTGTCACATGTA Locus tag: DORLON_01089 Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16) Locus tag: DORLON_01088 Name: nadC Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) Locus tag: DORLON_01087 Name: niaR Funciton: NAD biosynthesis transcription regulator, HTH_11 family
	DORLON_01089	nadB	L-aspartate oxidase (EC 1.4.3.16)
	DORLON_01088	nadC	Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
	DORLON_01087	niaR	NAD biosynthesis transcription regulator, HTH_11 family
Position: -98 Score: 6.4 Sequence: GACATGTGACAAGACACATGTA Locus tag: DORLON_02159 Name: niaY Funciton: Predicted nicotinate-regulated transporter NiaY
	DORLON_02159	niaY	Predicted nicotinate-regulated transporter NiaY

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD