Regulon of NiaR in Roseburia intestinalis L1-82
| Regulator type: | Transcription factor |
| TF locus tag: | ROSINTL182_03921 |
| Regulator family: | NiaR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Niacin |
| Regulog: | NiaR - Clostridia-3 |
| Statistics of regulated genes: | |
| - Genes | 1 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Clostridia-3
- By TF family - NiaR
- By effector - Niacin
- By pathway - NAD biosynthesis
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -69
Score: 6.2 Sequence: AACATGTGTCTTGTCATATGTA
Locus tag: ROSINTL182_03917
Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-) |
|||
|
nadA
|
Quinolinate synthetase (EC 4.1.99.-)
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |