Regulon of NiaR in Roseburia intestinalis L1-82

Properties
Regulator type:	Transcription factor
TF locus tag:	ROSINTL182_03921
Regulator family:	NiaR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Niacin
Regulog:	NiaR - Clostridia-3
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By TF family - NiaR
By effector - Niacin
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -69 Score: 6.2 Sequence: AACATGTGTCTTGTCATATGTA Locus tag: ROSINTL182_03917 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-)
	ROSINTL182_03917	nadA	Quinolinate synthetase (EC 4.1.99.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD