Regulon of NiaR in Dorea formicigenerans ATCC 27755

Properties
Regulator type:	Transcription factor
TF locus tag:	DORFOR_02387
Regulator family:	NiaR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Niacin
Regulog:	NiaR - Clostridia-3
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By TF family - NiaR
By effector - Niacin
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -47 Score: 4.9 Sequence: ACTTACTGTCTTGTCACATGTA Locus tag: DORFOR_01504 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-) Locus tag: DORFOR_01505 Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16) Locus tag: DORFOR_01506 Name: nadC Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
	DORFOR_01504	nadA	Quinolinate synthetase (EC 4.1.99.-)
	DORFOR_01505	nadB	L-aspartate oxidase (EC 1.4.3.16)
	DORFOR_01506	nadC	Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD