Regulon of NiaR in Eubacterium rectale ATCC 33656

Properties
Regulator type:	Transcription factor
TF locus tag:	EUBREC_1036
Regulator family:	NiaR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Niacin
Regulog:	NiaR - Clostridia-3
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By TF family - NiaR
By effector - Niacin
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -129 Score: 6.3 Sequence: TACAGGTGTCTTGTCAGTTGTA Locus tag: EUBREC_1034 Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16) Locus tag: EUBREC_1035 Name: nadC Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) Locus tag: EUBREC_1036 Name: niaR Funciton: NAD biosynthesis transcription regulator, HTH_11 family
	EUBREC_1034	nadB	L-aspartate oxidase (EC 1.4.3.16)
	EUBREC_1035	nadC	Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
	EUBREC_1036	niaR	NAD biosynthesis transcription regulator, HTH_11 family
Position: -173 Score: 6.3 Sequence: TACAACTGACAAGACACCTGTA Locus tag: EUBREC_1033 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-)
	EUBREC_1033	nadA	Quinolinate synthetase (EC 4.1.99.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD