Regulog HrcA - Lactobacillaceae

Member of regulog collections
- By taxonomy - Lactobacillaceae
- By trascription factor - HrcA
- By TF family - HrcA
- By effector - Heat shock
- By pathway - Heat shock response
Genome | Genes | Operons |
---|---|---|
Lactobacillus acidophilus NCFM | 10 | 6 |
Lactobacillus brevis ATCC 367 | 7 | 3 |
Lactobacillus casei ATCC 334 | 9 | 5 |
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | 9 | 5 |
Lactobacillus fermentum IFO 3956 | 8 | 4 |
Lactobacillus helveticus DPC 4571 | 6 | 5 |
Lactobacillus johnsonii NCC 533 | 10 | 6 |
Lactobacillus plantarum WCFS1 | 7 | 3 |
Lactobacillus reuteri JCM 1112 | 8 | 4 |
Lactobacillus rhamnosus GG | 9 | 5 |
Lactobacillus sakei subsp. sakei 23K | 8 | 4 |
Lactobacillus salivarius subsp. salivarius UCC118 | 6 | 2 |
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | 8 | 4 |
Oenococcus oeni PSU-1 | ||
Pediococcus pentosaceus ATCC 25745 | 7 | 3 |
Genes | Function | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
CRON 1. | ||||||||||||||||
groS |
*
Lactobacillus acidophilus NCFM Site: position = -159 score = 7.57035 sequence = TTAGCACTTTTTTATAAAGAGTGCTAA Site: position = -84 score = 6.77276 sequence = TTAGCACTTAACTAAAAGGAGTGCTAA Gene: LBA0405: Heat shock protein 60 family co-chaperone GroES |
*
Lactobacillus brevis ATCC 367 Site: position = -62 score = 6.38314 sequence = TTAGCACTTATGTTAGTCAAGTGCTAA Gene: LVIS_0617: Heat shock protein 60 family co-chaperone GroES |
*
Lactobacillus casei ATCC 334 Site: position = -56 score = 6.69177 sequence = TTAGCACTTAGACATAACGAGTGCTAA Gene: LSEI_2239: Heat shock protein 60 family co-chaperone GroES |
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Site: position = -140 score = 6.47748 sequence = TTAGCACTCTCGACTAAAAAGTGCTAT Site: position = -65 score = 6.74171 sequence = TTAGCACTTGATCAAGATGAGTGCTAA Gene: LBUL_1497: Heat shock protein 60 family co-chaperone GroES |
*
Lactobacillus fermentum IFO 3956 Site: position = -87 score = 5.68261 sequence = TTAGCACTTGAGGGGGTTGAGTGCTAG Gene: LAF_0325: Heat shock protein 60 family co-chaperone GroES |
*
Lactobacillus helveticus DPC 4571 Site: position = -159 score = 6.93654 sequence = TTAGCACTATTTGTAAAAAAGTGCTAA Site: position = -85 score = 7.10963 sequence = TTAGCACTTAAGAAATAAGAGTGCTAA Gene: lhv_0425: Heat shock protein 60 family co-chaperone GroES |
*
Lactobacillus johnsonii NCC 533 Site: position = -70 score = 6.99581 sequence = TTAGCACTTATAATATATGAGTGCTAA Site: position = -155 score = 6.90348 sequence = TTAGCACTCTGATGATAAAAGTGCTAA Gene: LJ0460: Heat shock protein 60 family co-chaperone GroES |
*
Lactobacillus plantarum WCFS1 Site: position = -51 score = 6.44742 sequence = TTAGCACTTGAGGTTGAGGAGTGCTAA Gene: lp_0727: Heat shock protein 60 family co-chaperone GroES |
*
Lactobacillus reuteri JCM 1112 Site: position = -61 score = 6.54297 sequence = TTAGCACTTGAAGAGTTTGAGTGCTAA Gene: LAR_0342: Heat shock protein 60 family co-chaperone GroES |
*
Lactobacillus rhamnosus GG Site: position = -56 score = 6.58813 sequence = TTAGCACTTAGACACAACGAGTGCTAA Gene: LGG_02240: Heat shock protein 60 family co-chaperone GroES |
*
Lactobacillus sakei subsp. sakei 23K Site: position = -55 score = 6.80435 sequence = TTAGCACTTGAGTGTTTAGAGTGCTAA Gene: LSA0358: Heat shock protein 60 family co-chaperone GroES |
*
Lactobacillus salivarius subsp. salivarius UCC118 Site: position = -61 score = 7.04627 sequence = TTAGCACTCAAGAGTTGAGAGTGCTAA Site: position = -135 score = 6.44129 sequence = TTAGCACTCTAATGTGTCGAGTGATAA Gene: LSL_1212: Heat shock protein 60 family co-chaperone GroES |
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Site: position = -54 score = 7.52017 sequence = TTAGCACTCACGTTTAAAGAGTGCTAA Gene: LEUM_1763: Heat shock protein 60 family co-chaperone GroES |
Gene: OEOE_1397: Heat shock protein 60 family co-chaperone GroES |
*
Pediococcus pentosaceus ATCC 25745 Site: position = -65 score = 6.34116 sequence = TTAGCACTTAGAGATGACGAGTGCTAA Gene: PEPE_0420: Heat shock protein 60 family co-chaperone GroES |
Heat shock protein 60 family co-chaperone GroES |
groL |
Gene: LBA0406: Heat shock protein 60 family chaperone GroEL |
Gene: LVIS_0618: Heat shock protein 60 family chaperone GroEL |
Gene: LSEI_2238: Heat shock protein 60 family chaperone GroEL |
Gene: LBUL_1496: Heat shock protein 60 family chaperone GroEL |
Gene: LAF_0326: Heat shock protein 60 family chaperone GroEL |
Gene: lhv_0426: Heat shock protein 60 family chaperone GroEL |
Gene: LJ0461: Heat shock protein 60 family chaperone GroEL |
Gene: lp_0728: Heat shock protein 60 family chaperone GroEL |
Gene: LAR_0343: Heat shock protein 60 family chaperone GroEL |
Gene: LGG_02239: Heat shock protein 60 family chaperone GroEL |
Gene: LSA0359: Heat shock protein 60 family chaperone GroEL |
Gene: LSL_1211: Heat shock protein 60 family chaperone GroEL |
Gene: LEUM_1762: Heat shock protein 60 family chaperone GroEL |
Gene: OEOE_1396: Heat shock protein 60 family chaperone GroEL |
Gene: PEPE_0421: Heat shock protein 60 family chaperone GroEL |
Heat shock protein 60 family chaperone GroEL |
CRON 2. | ||||||||||||||||
clpL |
*
Lactobacillus acidophilus NCFM Site: position = -70 score = 6.79138 sequence = TTAGCACTTGACTACCAAGAGTGCTAA Gene: LBA0638: ATP-dependent Clp protease, ATP-binding subunit |
*
Lactobacillus brevis ATCC 367 Site: position = -205 score = 6.39825 sequence = TTAGCATTCTATTGACGAGAGTGCTAG Gene: LVIS_1554: ATP-dependent Clp protease, ATP-binding subunit |
*
Lactobacillus casei ATCC 334 Site: position = -257 score = 5.94618 sequence = TTAGCACTCTTAGTGGCAGAGTGCTTG Gene: LSEI_1762: ATP-dependent Clp protease, ATP-binding subunit |
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Site: position = -201 score = 6.86013 sequence = TTAGCACTTGACTAACTAGAGTGCTAA Gene: LBUL_0510: ATP-dependent Clp protease, ATP-binding subunit |
*
Lactobacillus fermentum IFO 3956 Site: position = -190 score = 5.61671 sequence = TTAGCATTAGTTGCCAATCAGTGCTAA Gene: LAF_1388: ATP-dependent Clp protease, ATP-binding subunit |
*
Lactobacillus helveticus DPC 4571 Site: position = -71 score = 6.73825 sequence = TTAGCACTTGACTACTAAGAGTGCTAA Gene: lhv_0683: ATP-dependent Clp protease, ATP-binding subunit |
*
Lactobacillus johnsonii NCC 533 Site: position = -70 score = 7.62086 sequence = TTAGCACTCATATATCAAGAGTGCTAA Gene: LJ0815: ATP-dependent Clp protease, ATP-binding subunit |
Gene: lp_1269: ATP-dependent Clp protease, ATP-binding subunit |
*
Lactobacillus reuteri JCM 1112 Site: position = -211 score = 6.88088 sequence = TTAGCATTCATGGCTAAAGAGTGCTAA Gene: LAR_1257: ATP-dependent Clp protease, ATP-binding subunit |
*
Lactobacillus rhamnosus GG Site: position = -128 score = 6.21242 sequence = TTAGCACTCTTGCGGTTAGAGTGCTTG Gene: LGG_01823: ATP-dependent Clp protease, ATP-binding subunit |
Gene: LSA1465: ATP-dependent Clp protease, ATP-binding subunit |
Gene: LSL_0386: ATP-dependent Clp protease, ATP-binding subunit |
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Site: position = -151 score = 7.56854 sequence = TTAGCACTCTACTTTAAAGAGTGCTAA Gene: LEUM_0571: ATP-dependent Clp protease, ATP-binding subunit |
Gene: OEOE_0640: ATP-dependent Clp protease, ATP-binding subunit |
Gene: PEPE_0607: ATP-dependent Clp protease, ATP-binding subunit |
ATP-dependent Clp protease, ATP-binding subunit |
CRON 3. | ||||||||||||||||
hsp |
*
Lactobacillus acidophilus NCFM Site: position = -126 score = 7.14589 sequence = TTAGCACTAAATATTAAAGAGTGCTAA Gene: LBA0205: Small heat shock protein |
|
*
Lactobacillus casei ATCC 334 Site: position = -97 score = 6.68345 sequence = TTAGCACTCGACGTTTGCGAGTGCTAA Gene: LSEI_2800: Small heat shock protein |
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Site: position = -154 score = 6.02903 sequence = TTAGCAGTCAAAAAAGCTGAATGCTAA Gene: LBUL_0243: Small heat shock protein |
Gene: LAF_1369: Small heat shock protein |
*
Lactobacillus helveticus DPC 4571 Site: position = -130 score = 6.10771 sequence = TTAGCACTATATGCTTTTGAATGCTAA Gene: lhv_0222: Small heat shock protein |
*
Lactobacillus johnsonii NCC 533 Site: position = -78 score = 5.89737 sequence = TTAGCACCGTTCTAATTAGTGTGCTAA Gene: LJ0181: Small heat shock protein |
*
Lactobacillus plantarum WCFS1 Site: position = -149 score = 7.51584 sequence = TTAGCACTCGAGTTAAACGAGTGCTAA Gene: lp_0129: Small heat shock protein |
Gene: LAR_1239: Small heat shock protein |
*
Lactobacillus rhamnosus GG Site: position = -97 score = 7.12193 sequence = TTAGCACTCTAACATGACGAGTGCTAA Gene: LGG_02804: Small heat shock protein |
*
Lactobacillus sakei subsp. sakei 23K Site: position = -96 score = 7.72943 sequence = TTAGCACTCGTGATAAAAGAGTGCTAA Gene: LSA0050: Small heat shock protein |
|
|
Gene: OEOE_0289: Small heat shock protein |
Gene: PEPE_1643: Small heat shock protein |
Small heat shock protein |
CRON 4. | ||||||||||||||||
clpP |
*
Lactobacillus acidophilus NCFM Site: position = -59 score = 6.14018 sequence = TTAGCACAGTACTTGTATGAGTGCTAA Gene: LBA0694: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92) |
Gene: LVIS_0654: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92) |
*
Lactobacillus casei ATCC 334 Site: position = -51 score = 6.90671 sequence = TTAGCACTGTACTTTTAAGAGTGCTAA Gene: LSEI_0963: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92) |
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Site: position = -49 score = 7.12972 sequence = TTAGCACTGTATCTAAATGAGTGCTAA Gene: LBUL_0559: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92) |
*
Lactobacillus fermentum IFO 3956 Site: position = -44 score = 5.54311 sequence = TTAGCAAACAGTACTAACTAGTGCTAA Gene: LAF_0360: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92) |
*
Lactobacillus helveticus DPC 4571 Site: position = -60 score = 6.56372 sequence = TTAGCACAGTACTTAAAAGAGTGCTAA Gene: lhv_0735: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92) |
*
Lactobacillus johnsonii NCC 533 Site: position = -49 score = 6.87183 sequence = TTAGCACTGTACTTATTAGAGTGCTAA Gene: LJ0869: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92) |
Gene: lp_0786: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92) |
*
Lactobacillus reuteri JCM 1112 Site: position = -47 score = 5.75988 sequence = TTAGCATATAAGACTAACGAGTGCTAA Gene: LAR_0379: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92) |
*
Lactobacillus rhamnosus GG Site: position = -54 score = 7.03837 sequence = TTAGCACTGTACTTTAAAGAGTGCTAA Gene: LGG_00931: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92) |
Gene: LSA0531: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92) |
Gene: LSL_1168: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92) |
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Site: position = -81 score = 6.36407 sequence = TTAGCACTCTCGTCTCTAATGTGCTAA Gene: LEUM_0396: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92) |
Gene: OEOE_0570: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92) |
Gene: PEPE_0455: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92) |
ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92) |
CRON 5. | ||||||||||||||||
clpC |
*
Lactobacillus acidophilus NCFM Site: position = -57 score = 6.94857 sequence = TTAGCACTCAACGCACTAGAGTGCTAA Gene: LBA1910: ATP-dependent Clp protease ATP-binding subunit ClpA |
|
Gene: LSEI_2048: ATP-dependent Clp protease ATP-binding subunit ClpA |
Gene: LBUL_1944: ATP-dependent Clp protease ATP-binding subunit ClpA |
Gene: LAF_0033: ATP-dependent Clp protease ATP-binding subunit ClpA |
*
Lactobacillus helveticus DPC 4571 Site: position = -59 score = 5.91198 sequence = TTAGCACTTGAAGGCTTTAAGTGCTAA Gene: lhv_2043: ATP-dependent Clp protease ATP-binding subunit ClpA |
*
Lactobacillus johnsonii NCC 533 Site: position = -58 score = 6.7485 sequence = TTAGCACTTATAACTTATGAGTGCTAA Gene: LJ1775: ATP-dependent Clp protease ATP-binding subunit ClpA |
Gene: lp_3583: ATP-dependent Clp protease ATP-binding subunit ClpA |
Gene: LAR_0043: ATP-dependent Clp protease ATP-binding subunit ClpA |
Gene: LGG_02035: ATP-dependent Clp protease ATP-binding subunit ClpA |
*
Lactobacillus sakei subsp. sakei 23K Site: position = -121 score = 5.92811 sequence = GTGGCACTTTTCTTGCTAGAGTGCTAA Gene: LSA0207: ATP-dependent Clp protease ATP-binding subunit ClpA |
Gene: LSL_0059: ATP-dependent Clp protease ATP-binding subunit ClpA |
Gene: LEUM_0150: ATP-dependent Clp protease ATP-binding subunit ClpA |
Gene: OEOE_0572: ATP-dependent Clp protease ATP-binding subunit ClpA |
*
Pediococcus pentosaceus ATCC 25745 Site: position = -122 score = 6.93594 sequence = TTAGCACTTTACTTAACAGAGTGCTAA Gene: PEPE_0976: ATP-dependent Clp protease ATP-binding subunit ClpA |
ATP-dependent Clp protease ATP-binding subunit ClpA |
CRON 6. | ||||||||||||||||
hrcA |
*
Lactobacillus acidophilus NCFM Site: position = -93 score = 6.11494 sequence = TTAGCACTCAGGTTGCATTATTGCTAA Site: position = -45 score = 6.05514 sequence = TTAGCACCTGATAGATGTGAGTGCTAA Gene: LBA1249: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Lactobacillus brevis ATCC 367 Site: position = -43 score = 6.85471 sequence = TTAGCACTTGTGTTGTTTGAGTGCTAA Site: position = -127 score = 6.12175 sequence = TTAGCACTTAATTACGTTGATTGCTAA Gene: LVIS_1331: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Lactobacillus casei ATCC 334 Site: position = -42 score = 7.58073 sequence = TTAGCACTCATATAAAACGAGTGCTAA Gene: LSEI_1567: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Site: position = -92 score = 5.68638 sequence = TTAGCATTCTCCTTGACTAACTGCTAA Gene: LBUL_1229: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Lactobacillus fermentum IFO 3956 Site: position = -33 score = 6.38838 sequence = TTAGCACTTAGATGGCCAGAGTGCTAA Gene: LAF_0749: Heat shock response transcriptional regulator HrcA, HrcA family |
|
*
Lactobacillus johnsonii NCC 533 Site: position = -91 score = 6.37663 sequence = TTAGCACTCTACTTGAACAATTGCTAA Site: position = -43 score = 6.26953 sequence = TTAGCACAGAAGAAAGAAGAGTGCTAA Gene: LJ1481: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Lactobacillus plantarum WCFS1 Site: position = -191 score = 7.14508 sequence = TTAGCACTCGTAAGTAAGGAGTGCTAA Site: position = -36 score = 6.67783 sequence = TTAGCACTCCATTAAGTTAAGTGCTAA Gene: lp_2029: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Lactobacillus reuteri JCM 1112 Site: position = -45 score = 6.49439 sequence = TTAGCACTTGACCCTAATGAGTGCTAA Gene: LAR_0677: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Lactobacillus rhamnosus GG Site: position = -42 score = 7.61077 sequence = TTAGCACTCGTGTAAAACGAGTGCTAA Gene: LGG_01606: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Lactobacillus sakei subsp. sakei 23K Site: position = -41 score = 6.98636 sequence = TTAGCACTCGTAATAATCAAGTGCTAA Gene: LSA1238: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Lactobacillus salivarius subsp. salivarius UCC118 Site: position = -41 score = 6.58277 sequence = TTAGCACTCTAATGTGTTAAGTGCTAA Gene: LSL_0576: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Site: position = -41 score = 6.31919 sequence = TTAGCAGTTAGATATAGTGAGTGCTAA Site: position = -110 score = 7.38035 sequence = TTGGCACTCTTATAAAAAGAGTGCTAA Gene: LEUM_1349: Heat shock response transcriptional regulator HrcA, HrcA family |
|
*
Pediococcus pentosaceus ATCC 25745 Site: position = -41 score = 6.35998 sequence = TTAGCACTCCAACTTTCTAAGTGCTAA Gene: PEPE_0894: Heat shock response transcriptional regulator HrcA, HrcA family |
Heat shock response transcriptional regulator HrcA, HrcA family |
grpE |
Gene: LBA1248: Heat shock protein GrpE |
Gene: LVIS_1330: Heat shock protein GrpE |
Gene: LSEI_1566: Heat shock protein GrpE |
Gene: LBUL_1228: Heat shock protein GrpE |
Gene: LAF_0750: Heat shock protein GrpE |
|
Gene: LJ1480: Heat shock protein GrpE |
Gene: lp_2028: Heat shock protein GrpE |
Gene: LAR_0678: Heat shock protein GrpE |
Gene: LGG_01605: Heat shock protein GrpE |
Gene: LSA1237: Heat shock protein GrpE |
Gene: LSL_0577: Heat shock protein GrpE |
Gene: LEUM_1348: Heat shock protein GrpE |
Gene: OEOE_1310: Heat shock protein GrpE |
Gene: PEPE_0895: Heat shock protein GrpE |
Heat shock protein GrpE |
dnaK |
Gene: LBA1247: Chaperone protein DnaK |
Gene: LVIS_1329: Chaperone protein DnaK |
Gene: LSEI_1565: Chaperone protein DnaK |
Gene: LBUL_1227: Chaperone protein DnaK |
Gene: LAF_0751: Chaperone protein DnaK |
Gene: lhv_1336: Chaperone protein DnaK |
Gene: LJ1479: Chaperone protein DnaK |
Gene: lp_2027: Chaperone protein DnaK |
Gene: LAR_0679: Chaperone protein DnaK |
Gene: LGG_01604: Chaperone protein DnaK |
Gene: LSA1236: Chaperone protein DnaK |
Gene: LSL_0578: Chaperone protein DnaK |
Gene: LEUM_1347: Chaperone protein DnaK |
Gene: OEOE_1309: Chaperone protein DnaK |
Gene: PEPE_0896: Chaperone protein DnaK |
Chaperone protein DnaK |
dnaJ |
Gene: LBA1246: Chaperone protein DnaJ |
Gene: LVIS_1328: Chaperone protein DnaJ |
Gene: LSEI_1563: Chaperone protein DnaJ |
Gene: LBUL_1226: Chaperone protein DnaJ |
Gene: LAF_0752: Chaperone protein DnaJ |
Gene: lhv_1335: Chaperone protein DnaJ |
Gene: LJ1478: Chaperone protein DnaJ |
Gene: lp_2026: Chaperone protein DnaJ |
Gene: LAR_0680: Chaperone protein DnaJ |
Gene: LGG_01603: Chaperone protein DnaJ |
Gene: LSA1235: Chaperone protein DnaJ |
Gene: LSL_0579: Chaperone protein DnaJ |
Gene: LEUM_1346: Chaperone protein DnaJ |
Gene: OEOE_1308: Chaperone protein DnaJ |
Gene: PEPE_0897: Chaperone protein DnaJ |
Chaperone protein DnaJ |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |