Regulon of HrcA in Lactobacillus brevis ATCC 367

Properties
Regulator type:	Transcription factor
TF locus tag:	LVIS_1331
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Lactobacillaceae
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 69 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -127 Score: 6.1 Sequence: TTAGCACTTAATTACGTTGATTGCTAA Position: -43 Score: 6.9 Sequence: TTAGCACTTGTGTTGTTTGAGTGCTAA Locus tag: LVIS_1331 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: LVIS_1330 Name: grpE Funciton: Heat shock protein GrpE Locus tag: LVIS_1329 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: LVIS_1328 Name: dnaJ Funciton: Chaperone protein DnaJ
	LVIS_1331	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	LVIS_1330	grpE	Heat shock protein GrpE
	LVIS_1329	dnaK	Chaperone protein DnaK
	LVIS_1328	dnaJ	Chaperone protein DnaJ
Position: -62 Score: 6.4 Sequence: TTAGCACTTATGTTAGTCAAGTGCTAA Locus tag: LVIS_0617 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: LVIS_0618 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	LVIS_0617	groS	Heat shock protein 60 family co-chaperone GroES
	LVIS_0618	groL	Heat shock protein 60 family chaperone GroEL
Position: -205 Score: 6.4 Sequence: TTAGCATTCTATTGACGAGAGTGCTAG Locus tag: LVIS_1554 Name: clpL Funciton: ATP-dependent Clp protease, ATP-binding subunit
	LVIS_1554	clpL	ATP-dependent Clp protease, ATP-binding subunit

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD