Regulon of HrcA in Lactobacillus fermentum IFO 3956

Properties
Regulator type:	Transcription factor
TF locus tag:	LAF_0749
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Lactobacillaceae
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 69 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -190 Score: 5.6 Sequence: TTAGCATTAGTTGCCAATCAGTGCTAA Locus tag: LAF_1388 Name: clpL Funciton: ATP-dependent Clp protease, ATP-binding subunit
	LAF_1388	clpL	ATP-dependent Clp protease, ATP-binding subunit
Position: -87 Score: 5.7 Sequence: TTAGCACTTGAGGGGGTTGAGTGCTAG Locus tag: LAF_0325 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: LAF_0326 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	LAF_0325	groS	Heat shock protein 60 family co-chaperone GroES
	LAF_0326	groL	Heat shock protein 60 family chaperone GroEL
Position: -33 Score: 6.4 Sequence: TTAGCACTTAGATGGCCAGAGTGCTAA Locus tag: LAF_0749 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: LAF_0750 Name: grpE Funciton: Heat shock protein GrpE Locus tag: LAF_0751 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: LAF_0752 Name: dnaJ Funciton: Chaperone protein DnaJ
	LAF_0749	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	LAF_0750	grpE	Heat shock protein GrpE
	LAF_0751	dnaK	Chaperone protein DnaK
	LAF_0752	dnaJ	Chaperone protein DnaJ
Position: -44 Score: 5.5 Sequence: TTAGCAAACAGTACTAACTAGTGCTAA Locus tag: LAF_0360 Name: clpP Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
	LAF_0360	clpP	ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD