Regulon of HrcA in Lactobacillus salivarius subsp. salivarius UCC118

Properties
Regulator type:	Transcription factor
TF locus tag:	LSL_0576
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Lactobacillaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 69 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -135 Score: 6.4 Sequence: TTAGCACTCTAATGTGTCGAGTGATAA Position: -61 Score: 7 Sequence: TTAGCACTCAAGAGTTGAGAGTGCTAA Locus tag: LSL_1212 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: LSL_1211 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	LSL_1212	groS	Heat shock protein 60 family co-chaperone GroES
	LSL_1211	groL	Heat shock protein 60 family chaperone GroEL
Position: -41 Score: 6.6 Sequence: TTAGCACTCTAATGTGTTAAGTGCTAA Locus tag: LSL_0576 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: LSL_0577 Name: grpE Funciton: Heat shock protein GrpE Locus tag: LSL_0578 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: LSL_0579 Name: dnaJ Funciton: Chaperone protein DnaJ
	LSL_0576	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	LSL_0577	grpE	Heat shock protein GrpE
	LSL_0578	dnaK	Chaperone protein DnaK
	LSL_0579	dnaJ	Chaperone protein DnaJ

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD