Regulon of HrcA in Lactobacillus sakei subsp. sakei 23K

Properties
Regulator type:	Transcription factor
TF locus tag:	LSA1238
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Lactobacillaceae
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 69 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -96 Score: 7.7 Sequence: TTAGCACTCGTGATAAAAGAGTGCTAA Locus tag: LSA0050 Name: hsp Funciton: Small heat shock protein
	LSA0050	hsp	Small heat shock protein
Position: -121 Score: 5.9 Sequence: GTGGCACTTTTCTTGCTAGAGTGCTAA Locus tag: LSA0207 Name: clpC Funciton: ATP-dependent Clp protease ATP-binding subunit ClpA
	LSA0207	clpC	ATP-dependent Clp protease ATP-binding subunit ClpA
Position: -41 Score: 7 Sequence: TTAGCACTCGTAATAATCAAGTGCTAA Locus tag: LSA1238 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: LSA1237 Name: grpE Funciton: Heat shock protein GrpE Locus tag: LSA1236 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: LSA1235 Name: dnaJ Funciton: Chaperone protein DnaJ
	LSA1238	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	LSA1237	grpE	Heat shock protein GrpE
	LSA1236	dnaK	Chaperone protein DnaK
	LSA1235	dnaJ	Chaperone protein DnaJ
Position: -55 Score: 6.8 Sequence: TTAGCACTTGAGTGTTTAGAGTGCTAA Locus tag: LSA0358 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: LSA0359 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	LSA0358	groS	Heat shock protein 60 family co-chaperone GroES
	LSA0359	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD