Regulon of HrcA in Lactobacillus helveticus DPC 4571

Properties
Regulator type:	Transcription factor
TF locus tag:
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Lactobacillaceae
Statistics of regulated genes:
- Genes	6
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 69 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -71 Score: 6.7 Sequence: TTAGCACTTGACTACTAAGAGTGCTAA Locus tag: lhv_0683 Name: clpL Funciton: ATP-dependent Clp protease, ATP-binding subunit
	lhv_0683	clpL	ATP-dependent Clp protease, ATP-binding subunit
Position: -59 Score: 5.9 Sequence: TTAGCACTTGAAGGCTTTAAGTGCTAA Locus tag: lhv_2043 Name: clpC Funciton: ATP-dependent Clp protease ATP-binding subunit ClpA
	lhv_2043	clpC	ATP-dependent Clp protease ATP-binding subunit ClpA
Position: -130 Score: 6.1 Sequence: TTAGCACTATATGCTTTTGAATGCTAA Locus tag: lhv_0222 Name: hsp Funciton: Small heat shock protein
	lhv_0222	hsp	Small heat shock protein
Position: -60 Score: 6.6 Sequence: TTAGCACAGTACTTAAAAGAGTGCTAA Locus tag: lhv_0735 Name: clpP Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
	lhv_0735	clpP	ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
Position: -159 Score: 6.9 Sequence: TTAGCACTATTTGTAAAAAAGTGCTAA Position: -85 Score: 7.1 Sequence: TTAGCACTTAAGAAATAAGAGTGCTAA Locus tag: lhv_0425 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: lhv_0426 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	lhv_0425	groS	Heat shock protein 60 family co-chaperone GroES
	lhv_0426	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD