Regulog PaaR - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Phenylacetic acid degradation |
| Effector: | Phenylacetyl-CoA |
| Phylum: | Alphaproteobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By trascription factor - PaaR
- By TF family - TetR
- By effector - Phenylacetyl-CoA
- By pathway - Phenylacetic acid degradation
| Genome | Genes | Operons |
|---|---|---|
| Nitrobacter winogradskyi Nb-255 | ||
| Bradyrhizobium sp. BTAi1 | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Rhodopseudomonas palustris CGA009 | 15 | 5 |
| Bartonella quintana str. Toulouse | ||
| Brucella melitensis 16M | ||
| Mesorhizobium loti MAFF303099 | ||
| Mesorhizobium sp. BNC1 | ||
| Agrobacterium tumefaciens str. C58 (Cereon) | ||
| Azorhizobium caulinodans ORS 571 | ||
| Rhizobium etli CFN 42 | ||
| Rhizobium leguminosarum bv. viciae 3841 | ||
| Rhizobium sp. NGR234 | 13 | 3 |
| Sinorhizobium meliloti 1021 | ||
| Xanthobacter autotrophicus Py2 | 19 | 4 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| livK |
|
|
|
*
Rhodopseudomonas palustris CGA009 Site: position = -144 score = 6.31073 sequence = ATTGACCGACCGTTCGGTTAAG Gene: RPA4019: Putative branched-chain amino acid ABC transporter, substrate-binding component |
|
|
|
|
|
|
|
|
|
|
*
Xanthobacter autotrophicus Py2 Site: position = -175 score = 5.29137 sequence = ATTGTCCGTCTGGTCGATCAAT Site: position = -117 score = 6.65276 sequence = ATTGACCATCCGGTCGGTCAAT Gene: Xaut_0893: Putative branched-chain amino acid ABC transporter, substrate-binding component |
Putative branched-chain amino acid ABC transporter, substrate-binding component |
| livH |
|
|
|
Gene: RPA4020: Putative branched-chain amino acid ABC transporter, permease component |
|
|
|
|
|
|
|
|
|
|
Gene: Xaut_0892: Putative branched-chain amino acid ABC transporter, permease component |
Putative branched-chain amino acid ABC transporter, permease component |
| livF |
|
|
|
Gene: RPA4021: Putative branched-chain amino acid ABC transporter, permease component 2 |
|
|
|
|
|
|
|
|
|
|
Gene: Xaut_0891: Putative branched-chain amino acid ABC transporter, permease component 2 |
Putative branched-chain amino acid ABC transporter, permease component 2 |
| livM1 |
|
|
|
Gene: RPA4022: utative branched-chain amino acid ABC transporter, ATPase component 1 |
|
|
|
|
|
|
|
|
|
|
Gene: Xaut_0890: utative branched-chain amino acid ABC transporter, ATPase component 1 |
utative branched-chain amino acid ABC transporter, ATPase component 1 |
| livM2 |
|
|
|
Gene: RPA4023: utative branched-chain amino acid ABC transporter, ATPase component 2 |
|
|
|
|
|
|
|
|
|
|
Gene: Xaut_0889: utative branched-chain amino acid ABC transporter, ATPase component 2 |
utative branched-chain amino acid ABC transporter, ATPase component 2 |
| CRON 2. | ||||||||||||||||
| paaG |
|
|
|
|
|
|
|
|
|
|
|
|
*
Rhizobium sp. NGR234 Site: position = -51 score = 6.46543 sequence = ATAAACCGACCGGTCAGTCAAT Gene: NGR_c26080: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: SMb21632: Enoyl-CoA hydratase (EC 4.2.1.17) |
|
Enoyl-CoA hydratase (EC 4.2.1.17) |
| CRON 3. | ||||||||||||||||
| blr2890 |
|
|
|
|
|
|
|
|
|
|
|
|
*
Rhizobium sp. NGR234 Site: position = -53 score = 5.72292 sequence = TCTGACCGATCGGTCGGTTAAT Gene: NGR_c26200: putative beta-ketoadipyl CoA thiolase |
|
|
putative beta-ketoadipyl CoA thiolase |
| paaA |
|
Gene: BBta_2865: Phenylacetate-CoA oxygenase, PaaA subunit |
Gene: blr2891: Phenylacetate-CoA oxygenase, PaaA subunit |
*
Rhodopseudomonas palustris CGA009 Site: position = -53 score = 5.90246 sequence = ATTGACCGTCCAATTGGTCAAT Gene: RPA3768: Phenylacetate-CoA oxygenase, PaaA subunit |
|
|
|
|
|
|
|
|
Gene: NGR_c26190: Phenylacetate-CoA oxygenase, PaaA subunit |
Gene: SMb21640: Phenylacetate-CoA oxygenase, PaaA subunit |
Gene: Xaut_0896: Phenylacetate-CoA oxygenase, PaaA subunit |
Phenylacetate-CoA oxygenase, PaaA subunit |
| paaB |
|
Gene: BBta_2866: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: bsr2892: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: RPA3767: Phenylacetate-CoA oxygenase, PaaB subunit |
|
|
|
|
|
|
|
|
Gene: NGR_c26180: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: SMb21639: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: Xaut_0897: Phenylacetate-CoA oxygenase, PaaB subunit |
Phenylacetate-CoA oxygenase, PaaB subunit |
| paaC |
|
Gene: BBta_2867: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: blr2893: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: RPA3766: Phenylacetate-CoA oxygenase, PaaC subunit |
|
|
|
|
|
|
|
|
Gene: NGR_c26170: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: SMb21638: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: Xaut_0898: Phenylacetate-CoA oxygenase, PaaC subunit |
Phenylacetate-CoA oxygenase, PaaC subunit |
| paaD |
|
Gene: BBta_2868: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: blr2894: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: RPA3765: Phenylacetate-CoA oxygenase, PaaD subunit |
|
|
|
|
|
|
|
|
Gene: NGR_c26160: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: SMb21637: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: Xaut_0899: Phenylacetate-CoA oxygenase, PaaD subunit |
Phenylacetate-CoA oxygenase, PaaD subunit |
| paaE |
|
Gene: BBta_2869: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: blr2895: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: RPA3764: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
|
|
|
|
|
|
|
|
Gene: NGR_c26150: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: SMb21636: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: Xaut_0900: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
| NGR_c26140 |
|
|
|
|
|
|
|
|
|
|
|
|
Gene: NGR_c26140: ring-oxidation complex protein 1 in the phenylacetic acid catabolism pathway |
|
|
ring-oxidation complex protein 1 in the phenylacetic acid catabolism pathway |
| paaZ |
|
|
|
*
Rhodopseudomonas palustris CGA009 Site: position = -108 score = 5.68053 sequence = ATTGAACGATCGGTCAGTCAAT Gene: RPA1725: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
|
|
|
|
|
|
|
|
Gene: NGR_c26130: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
Gene: SM_b21635: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
*2
Xanthobacter autotrophicus Py2 Site: position = -166 score = 6.21572 sequence = ATTAACCGATCGATCGGTTAAT Gene: Xaut_0904: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ Gene: Xaut_0907: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
| paaR |
|
|
|
*
Rhodopseudomonas palustris CGA009 Site: position = -91 score = 5.90246 sequence = ATTGACCAATTGGACGGTCAAT Gene: RPA3769: Transcriptional regulator of phenylacetic acid degradation, TetR family |
|
|
|
|
|
|
|
|
Gene: NGR_c26120: Transcriptional regulator of phenylacetic acid degradation, TetR family |
|
*
Xanthobacter autotrophicus Py2 Site: position = -118 score = 6.65276 sequence = ATTGACCGACCGGATGGTCAAT Site: position = -60 score = 5.29137 sequence = ATTGATCGACCAGACGGACAAT Gene: Xaut_0894: Transcriptional regulator of phenylacetic acid degradation, TetR family |
Transcriptional regulator of phenylacetic acid degradation, TetR family |
| paaX |
|
Gene: BBta_2864: Phenylacetic acid degradation operon negative regulatory protein PaaX |
Gene: blr2890: Phenylacetic acid degradation operon negative regulatory protein PaaX |
|
|
|
|
|
|
|
|
|
Gene: NGR_b11470: Phenylacetic acid degradation operon negative regulatory protein PaaX |
Gene: SMb21641: Phenylacetic acid degradation operon negative regulatory protein PaaX |
Gene: Xaut_0895: Phenylacetic acid degradation operon negative regulatory protein PaaX |
Phenylacetic acid degradation operon negative regulatory protein PaaX |
| paaF |
|
|
|
|
|
|
|
|
|
|
|
|
*
Rhizobium sp. NGR234 Site: position = -70 score = 6.46543 sequence = ATTGACTGACCGGTCGGTTTAT Gene: NGR_c26090: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: SMb21633: Enoyl-CoA hydratase (EC 4.2.1.17) |
*
Xanthobacter autotrophicus Py2 Site: position = -60 score = 6.21572 sequence = ATTAACCGATCGATCGGTTAAT Gene: Xaut_0903: Enoyl-CoA hydratase (EC 4.2.1.17) |
Enoyl-CoA hydratase (EC 4.2.1.17) |
| paaY |
|
Gene: BBta_2871: thioesterase superfamily protein |
Gene: blr2896: thioesterase superfamily protein |
*
Rhodopseudomonas palustris CGA009 Site: position = -138 score = 5.68053 sequence = ATTGACTGACCGATCGTTCAAT Gene: RPA1724: thioesterase superfamily protein |
|
|
|
|
|
|
|
|
Gene: NGR_c26100: thioesterase superfamily protein |
|
Gene: Xaut_0902: thioesterase superfamily protein |
thioesterase superfamily protein |
| paaK |
|
Gene: BBta_2870: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Gene: blr2897: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Gene: RPA1723: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
|
|
|
|
|
|
|
|
Gene: NGR_c26110: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
|
Gene: Xaut_0901: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
| paaJ |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Gene: Xaut_0905: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) |
Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) |
| fadB |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Gene: Xaut_0906: 3-hydroxyacyl-CoA dehydrogenase NAD-binding |
3-hydroxyacyl-CoA dehydrogenase NAD-binding |
| blr2898 |
|
|
Gene: blr2898: putative zinc binding dehydrogenase |
Gene: RPA1726: putative zinc binding dehydrogenase |
|
|
|
|
|
|
|
|
|
|
|
putative zinc binding dehydrogenase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |