Regulon of PaaR in Xanthobacter autotrophicus Py2

Properties
Regulator type:	Transcription factor
TF locus tag:	Xaut_0894
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Rhizobiales
Statistics of regulated genes:
- Genes	19
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -118 Score: 6.7 Sequence: ATTGACCGACCGGATGGTCAAT Position: -60 Score: 5.3 Sequence: ATTGATCGACCAGACGGACAAT Locus tag: Xaut_0894 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family Locus tag: Xaut_0895 Name: paaX Funciton: Phenylacetic acid degradation operon negative regulatory protein PaaX Locus tag: Xaut_0896 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: Xaut_0897 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: Xaut_0898 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: Xaut_0899 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: Xaut_0900 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	Xaut_0894	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family
	Xaut_0895	paaX	Phenylacetic acid degradation operon negative regulatory protein PaaX
	Xaut_0896	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	Xaut_0897	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	Xaut_0898	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	Xaut_0899	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	Xaut_0900	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Position: -60 Score: 6.2 Sequence: ATTAACCGATCGATCGGTTAAT Locus tag: Xaut_0903 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: Xaut_0902 Name: paaY Funciton: thioesterase superfamily protein Locus tag: Xaut_0901 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	Xaut_0903	paaF	Enoyl-CoA hydratase (EC 4.2.1.17)
	Xaut_0902	paaY	thioesterase superfamily protein
	Xaut_0901	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Position: -166 Score: 6.2 Sequence: ATTAACCGATCGATCGGTTAAT Locus tag: Xaut_0904 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ Locus tag: Xaut_0905 Name: paaJ Funciton: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) Locus tag: Xaut_0906 Name: fadB Funciton: 3-hydroxyacyl-CoA dehydrogenase NAD-binding Locus tag: Xaut_0907 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	Xaut_0904	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	Xaut_0905	paaJ	Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
	Xaut_0906	fadB	3-hydroxyacyl-CoA dehydrogenase NAD-binding
	Xaut_0907	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
Position: -175 Score: 5.3 Sequence: ATTGTCCGTCTGGTCGATCAAT Position: -117 Score: 6.7 Sequence: ATTGACCATCCGGTCGGTCAAT Locus tag: Xaut_0893 Name: livK Funciton: Putative branched-chain amino acid ABC transporter, substrate-binding component Locus tag: Xaut_0892 Name: livH Funciton: Putative branched-chain amino acid ABC transporter, permease component Locus tag: Xaut_0891 Name: livF Funciton: Putative branched-chain amino acid ABC transporter, permease component 2 Locus tag: Xaut_0890 Name: livM1 Funciton: utative branched-chain amino acid ABC transporter, ATPase component 1 Locus tag: Xaut_0889 Name: livM2 Funciton: utative branched-chain amino acid ABC transporter, ATPase component 2
	Xaut_0893	livK	Putative branched-chain amino acid ABC transporter, substrate-binding component
	Xaut_0892	livH	Putative branched-chain amino acid ABC transporter, permease component
	Xaut_0891	livF	Putative branched-chain amino acid ABC transporter, permease component 2
	Xaut_0890	livM1	utative branched-chain amino acid ABC transporter, ATPase component 1
	Xaut_0889	livM2	utative branched-chain amino acid ABC transporter, ATPase component 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of PaaR in Xanthobacter autotrophicus Py2

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --