Regulon of PaaR in Rhizobium sp. NGR234

Properties
Regulator type:	Transcription factor
TF locus tag:	NGR_c26120
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Rhizobiales
Statistics of regulated genes:
- Genes	13
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -70 Score: 6.5 Sequence: ATTGACTGACCGGTCGGTTTAT Locus tag: NGR_c26090 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: NGR_c26100 Name: paaY Funciton: thioesterase superfamily protein Locus tag: NGR_c26110 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) Locus tag: NGR_c26120 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
	NGR_c26090	paaF	Enoyl-CoA hydratase (EC 4.2.1.17)
	NGR_c26100	paaY	thioesterase superfamily protein
	NGR_c26110	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	NGR_c26120	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family
Position: -53 Score: 5.7 Sequence: TCTGACCGATCGGTCGGTTAAT Locus tag: NGR_c26200 Name: blr2890 Funciton: putative beta-ketoadipyl CoA thiolase Locus tag: NGR_c26190 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: NGR_c26180 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: NGR_c26170 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: NGR_c26160 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: NGR_c26150 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: NGR_c26140 Name: null Funciton: ring-oxidation complex protein 1 in the phenylacetic acid catabolism pathway Locus tag: NGR_c26130 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	NGR_c26200	blr2890	putative beta-ketoadipyl CoA thiolase
	NGR_c26190	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	NGR_c26180	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	NGR_c26170	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	NGR_c26160	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	NGR_c26150	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	NGR_c26140		ring-oxidation complex protein 1 in the phenylacetic acid catabolism pathway
	NGR_c26130	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
Position: -51 Score: 6.5 Sequence: ATAAACCGACCGGTCAGTCAAT Locus tag: NGR_c26080 Name: paaG Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
	NGR_c26080	paaG	Enoyl-CoA hydratase (EC 4.2.1.17)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD