Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing livH gene

Properties
Regulog: PaaR - Rhizobiales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Alphaproteobacteria
Built upon 14 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Rhodopseudomonas palustris CGA009
Position: -144
Score: 6.31073
Sequence: ATTGACCGACCGTTCGGTTAAG
Locus tag: RPA4019
Name: livK
Funciton: Putative branched-chain amino acid ABC transporter, substrate-binding component
Locus tag: RPA4020
Name: livH
Funciton: Putative branched-chain amino acid ABC transporter, permease component
Locus tag: RPA4021
Name: livF
Funciton: Putative branched-chain amino acid ABC transporter, permease component 2
Locus tag: RPA4022
Name: livM1
Funciton: utative branched-chain amino acid ABC transporter, ATPase component 1
Locus tag: RPA4023
Name: livM2
Funciton: utative branched-chain amino acid ABC transporter, ATPase component 2
livK-livH-livF-livM1-livM2 -144 6.3 ATTGACCGACCGTTCGGTTAAG RPA4019
Xanthobacter autotrophicus Py2
Position: -175
Score: 5.29137
Sequence: ATTGTCCGTCTGGTCGATCAAT
Position: -117
Score: 6.65276
Sequence: ATTGACCATCCGGTCGGTCAAT
Locus tag: Xaut_0893
Name: livK
Funciton: Putative branched-chain amino acid ABC transporter, substrate-binding component
Locus tag: Xaut_0892
Name: livH
Funciton: Putative branched-chain amino acid ABC transporter, permease component
Locus tag: Xaut_0891
Name: livF
Funciton: Putative branched-chain amino acid ABC transporter, permease component 2
Locus tag: Xaut_0890
Name: livM1
Funciton: utative branched-chain amino acid ABC transporter, ATPase component 1
Locus tag: Xaut_0889
Name: livM2
Funciton: utative branched-chain amino acid ABC transporter, ATPase component 2
livK-livH-livF-livM1-livM2 -175 5.3 ATTGTCCGTCTGGTCGATCAAT Xaut_0893
-117 6.7 ATTGACCATCCGGTCGGTCAAT