Orthologous regulated operons containing blr2890 gene

Properties
Regulog:	PaaR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Phylum:	Alphaproteobacteria

Built upon 14 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Rhizobium sp. NGR234
Position: -53 Score: 5.72292 Sequence: TCTGACCGATCGGTCGGTTAAT Locus tag: NGR_c26200 Name: blr2890 Funciton: putative beta-ketoadipyl CoA thiolase Locus tag: NGR_c26190 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: NGR_c26180 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: NGR_c26170 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: NGR_c26160 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: NGR_c26150 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: NGR_c26140 Name: null Funciton: ring-oxidation complex protein 1 in the phenylacetic acid catabolism pathway Locus tag: NGR_c26130 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
blr2890-paaA-paaB-paaC-paaD-paaE-NGR_c26140-paaZ	-53	5.7	TCTGACCGATCGGTCGGTTAAT	NGR_c26200

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --