Orthologous regulated operons containing paaJ gene

Properties
Regulog:	PaaR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Phylum:	Alphaproteobacteria

Built upon 14 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Xanthobacter autotrophicus Py2
Position: -166 Score: 6.21572 Sequence: ATTAACCGATCGATCGGTTAAT Locus tag: Xaut_0904 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ Locus tag: Xaut_0905 Name: paaJ Funciton: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) Locus tag: Xaut_0906 Name: fadB Funciton: 3-hydroxyacyl-CoA dehydrogenase NAD-binding Locus tag: Xaut_0907 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaZ-paaJ-fadB-paaZ	-166	6.2	ATTAACCGATCGATCGGTTAAT	Xaut_0904

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --