Orthologous regulated operons containing paaX gene

Properties
Regulog:	PaaR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Phylum:	Alphaproteobacteria

Built upon 14 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Xanthobacter autotrophicus Py2
Position: -118 Score: 6.65276 Sequence: ATTGACCGACCGGATGGTCAAT Position: -60 Score: 5.29137 Sequence: ATTGATCGACCAGACGGACAAT Locus tag: Xaut_0894 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family Locus tag: Xaut_0895 Name: paaX Funciton: Phenylacetic acid degradation operon negative regulatory protein PaaX Locus tag: Xaut_0896 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: Xaut_0897 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: Xaut_0898 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: Xaut_0899 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: Xaut_0900 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
paaR-paaX-paaA-paaB-paaC-paaD-paaE	-118	6.7	ATTGACCGACCGGATGGTCAAT	Xaut_0894
	-60	5.3	ATTGATCGACCAGACGGACAAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --