Regulon of PaaR in Rhodopseudomonas palustris CGA009

Properties
Regulator type:	Transcription factor
TF locus tag:	RPA3769
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Rhizobiales
Statistics of regulated genes:
- Genes	15
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -108 Score: 5.7 Sequence: ATTGAACGATCGGTCAGTCAAT Locus tag: RPA1725 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ Locus tag: RPA1726 Name: blr2898 Funciton: putative zinc binding dehydrogenase
	RPA1725	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	RPA1726	blr2898	putative zinc binding dehydrogenase
Position: -91 Score: 5.9 Sequence: ATTGACCAATTGGACGGTCAAT Locus tag: RPA3769 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
	RPA3769	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family
Position: -144 Score: 6.3 Sequence: ATTGACCGACCGTTCGGTTAAG Locus tag: RPA4019 Name: livK Funciton: Putative branched-chain amino acid ABC transporter, substrate-binding component Locus tag: RPA4020 Name: livH Funciton: Putative branched-chain amino acid ABC transporter, permease component Locus tag: RPA4021 Name: livF Funciton: Putative branched-chain amino acid ABC transporter, permease component 2 Locus tag: RPA4022 Name: livM1 Funciton: utative branched-chain amino acid ABC transporter, ATPase component 1 Locus tag: RPA4023 Name: livM2 Funciton: utative branched-chain amino acid ABC transporter, ATPase component 2
	RPA4019	livK	Putative branched-chain amino acid ABC transporter, substrate-binding component
	RPA4020	livH	Putative branched-chain amino acid ABC transporter, permease component
	RPA4021	livF	Putative branched-chain amino acid ABC transporter, permease component 2
	RPA4022	livM1	utative branched-chain amino acid ABC transporter, ATPase component 1
	RPA4023	livM2	utative branched-chain amino acid ABC transporter, ATPase component 2
Position: -138 Score: 5.7 Sequence: ATTGACTGACCGATCGTTCAAT Locus tag: RPA1724 Name: paaY Funciton: thioesterase superfamily protein Locus tag: RPA1723 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	RPA1724	paaY	thioesterase superfamily protein
	RPA1723	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Position: -53 Score: 5.9 Sequence: ATTGACCGTCCAATTGGTCAAT Locus tag: RPA3768 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: RPA3767 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: RPA3766 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: RPA3765 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: RPA3764 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	RPA3768	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	RPA3767	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	RPA3766	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	RPA3765	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	RPA3764	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of PaaR in Rhodopseudomonas palustris CGA009

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --