Regulog RutR - Pseudomonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - RutR
- By taxonomy - Pseudomonadaceae
- By TF family - TetR
- By effector - Uracil
- By pathway - Pyrimidine utilization
| Genome | Genes | Operons |
|---|---|---|
| Pseudomonas aeruginosa PAO1 | 12 | 4 |
| Pseudomonas entomophila L48 | 8 | 3 |
| Pseudomonas putida KT2440 | 7 | 2 |
| Pseudomonas syringae pv. tomato str. DC3000 | 12 | 4 |
| Pseudomonas fluorescens Pf-5 | 13 | 4 |
| Pseudomonas mendocina ymp | 12 | 5 |
| Pseudomonas stutzeri A1501 | 4 | 3 |
| Azotobacter vinelandii AvOP |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| ppuA |
*
Pseudomonas aeruginosa PAO1 Site: position = -65 score = 5.37429 sequence = TCCTGACCTCCTGGCCAGGT Gene: PA0136: Predicted ABC transporter, ATP-binding protein |
|
|
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -64 score = 5.60056 sequence = ACCTGACCCATTGGCCAGGA Gene: PSPTO0769: Predicted ABC transporter, ATP-binding protein |
*
Pseudomonas fluorescens Pf-5 Site: position = -22 score = 5.38842 sequence = TCCTGACCCACTGGCCAGGA Gene: PFL_0728: Predicted ABC transporter, ATP-binding protein |
|
Gene: PST_2907: Predicted ABC transporter, ATP-binding protein |
|
Predicted ABC transporter, ATP-binding protein |
| ppuC |
Gene: PA0137: Predicted ABC transporter, permease protein |
|
|
Gene: PSPTO0768: Predicted ABC transporter, permease protein |
Gene: PFL_0727: Predicted ABC transporter, permease protein |
|
Gene: PST_2908: Predicted ABC transporter, permease protein |
|
Predicted ABC transporter, permease protein |
| ppuD |
Gene: PA0138: Predicted ABC transporter, inner membrane protein precursor |
|
|
Gene: PSPTO0767: Predicted ABC transporter, inner membrane protein precursor |
Gene: PFL_0726: Predicted ABC transporter, inner membrane protein precursor |
|
Gene: PST_2909: Predicted ABC transporter, inner membrane protein precursor |
|
Predicted ABC transporter, inner membrane protein precursor |
| CRON 2. | |||||||||
| pbuT4 |
|
|
|
|
|
*
Pseudomonas mendocina ymp Site: position = -36 score = 5.57314 sequence = GCCTGACCAATCGGACAACA Gene: Pmen_4444: Xanthine/uracil permease |
|
|
Xanthine/uracil permease |
| CRON 3. | |||||||||
| upp |
Gene: PA4646: Uracil phosphoribosyltransferase (EC 2.4.2.9) |
Gene: PSEEN0888: Uracil phosphoribosyltransferase (EC 2.4.2.9) |
Gene: PP0746: Uracil phosphoribosyltransferase (EC 2.4.2.9) |
Gene: PSPTO1130: Uracil phosphoribosyltransferase (EC 2.4.2.9) |
Gene: PFL_5139: Uracil phosphoribosyltransferase (EC 2.4.2.9) |
Gene: Pmen_0946: Uracil phosphoribosyltransferase (EC 2.4.2.9) |
*
Pseudomonas stutzeri A1501 Site: position = -159 score = 5.25418 sequence = ACCTGACCGAACAGACTACT Gene: PST_3175: Uracil phosphoribosyltransferase (EC 2.4.2.9) |
Gene: Avin_41360: Uracil phosphoribosyltransferase (EC 2.4.2.9) |
Uracil phosphoribosyltransferase (EC 2.4.2.9) |
| uraA |
Gene: PA4647: Uracil permease |
Gene: PSEEN0887: Uracil permease |
Gene: PP0745: Uracil permease |
Gene: PSPTO1129: Uracil permease |
Gene: PFL_5140: Uracil permease |
Gene: Pmen_0945: Uracil permease |
Gene: PST_3176: Uracil permease |
|
Uracil permease |
| CRON 4. | |||||||||
| tsx3 |
|
|
|
|
|
*
Pseudomonas mendocina ymp Site: position = -92 score = 5.39399 sequence = AGCTGATCAGTTGGACAGCT Site: position = -54 score = 5.72201 sequence = ACCTGACCACACGGCCAGGA Gene: Pmen_3697: Nucleoside-binding outer membrane protein |
|
|
Nucleoside-binding outer membrane protein |
| pbuT |
*
Pseudomonas aeruginosa PAO1 Site: position = -77 score = 5.27576 sequence = AGCTGATCACCTGGACAGCT Gene: PA0166: Xanthine/uracil permease |
|
|
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -83 score = 5.05087 sequence = ACCTGAGCAGGTGGACAGTT Gene: PSPTO0772: Xanthine/uracil permease |
*
Pseudomonas fluorescens Pf-5 Site: position = -22 score = 5.34522 sequence = ACCTGAGCACCTGGACAGCT Gene: PFL_0731: Xanthine/uracil permease |
Gene: Pmen_3698: Xanthine/uracil permease |
|
Gene: Avin_29700: Xanthine/uracil permease |
Xanthine/uracil permease |
| rutR |
Gene: PA0167: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
Gene: PSEEN0679: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
Gene: PP0594: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
Gene: PSPTO0771: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
Gene: PFL_0730: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
Gene: Pmen_3699: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
Gene: PST_2863: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
|
Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
| COG1739 |
Gene: PA0168: hypothetical protein, COG1739 |
Gene: PSEEN0678: hypothetical protein, COG1739 |
Gene: PP0593: hypothetical protein, COG1739 |
Gene: PSPTO0770: hypothetical protein, COG1739 |
Gene: PFL_0729: hypothetical protein, COG1739 |
Gene: Pmen_3700: hypothetical protein, COG1739 |
Gene: PST_3607: hypothetical protein, COG1739 |
|
hypothetical protein, COG1739 |
| CRON 5. | |||||||||
| COG0726 |
*
Pseudomonas aeruginosa PAO1 Site: position = -157 score = 5.9972 sequence = AACTGACCAGTCGGGCAGGT Gene: PA1517: putative polysaccharide deacetylase family protein |
*
Pseudomonas entomophila L48 Site: position = -179 score = 6.02948 sequence = AACTGACCAATCGGGCAAGT Gene: PSEEN1685: putative polysaccharide deacetylase family protein |
*
Pseudomonas putida KT2440 Site: position = -189 score = 5.97513 sequence = AGCTGACCAAACAGGCAGGT Gene: PP4286: putative polysaccharide deacetylase family protein |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -169 score = 6.01396 sequence = AACTGACCAGTCAGGCAGGT Gene: PSPTO3666: putative polysaccharide deacetylase family protein |
*
Pseudomonas fluorescens Pf-5 Site: position = -189 score = 5.65122 sequence = AGCTGACCATCCAGGCAAGT Gene: PFL_4366: putative polysaccharide deacetylase family protein |
*
Pseudomonas mendocina ymp Site: position = -166 score = 5.77917 sequence = TGCTGACCACTCAGGCAATT Gene: Pmen_2758: putative polysaccharide deacetylase family protein |
Gene: PST_3093: putative polysaccharide deacetylase family protein |
Gene: Avin_21130: putative polysaccharide deacetylase family protein |
putative polysaccharide deacetylase family protein |
| pucL |
Gene: PA1516: Uricase (EC 1.7.3.3) |
Gene: PSEEN1684: Uricase (EC 1.7.3.3) |
Gene: PP4287: Uricase (EC 1.7.3.3) |
Gene: PSPTO3667: Uricase (EC 1.7.3.3) |
Gene: PFL_4367: Uricase (EC 1.7.3.3) |
Gene: Pmen_2759: Uricase (EC 1.7.3.3) |
Gene: PST_3094: Uricase (EC 1.7.3.3) |
Gene: Avin_21120: Uricase (EC 1.7.3.3) |
Uricase (EC 1.7.3.3) |
| allC |
Gene: PA1515: Allantoicase (EC 3.5.3.4) |
|
|
Gene: PSPTO3668: Allantoicase (EC 3.5.3.4) |
Gene: PFL_4368: Allantoicase (EC 3.5.3.4) |
|
Gene: PST_3095: Allantoicase (EC 3.5.3.4) |
Gene: Avin_21110: Allantoicase (EC 3.5.3.4) |
Allantoicase (EC 3.5.3.4) |
| allA |
Gene: PA1514: Ureidoglycolate hydrolase (EC 3.5.3.19) |
Gene: PSEEN1683: Ureidoglycolate hydrolase (EC 3.5.3.19) |
Gene: PP4288: Ureidoglycolate hydrolase (EC 3.5.3.19) |
Gene: PSPTO3669: Ureidoglycolate hydrolase (EC 3.5.3.19) |
Gene: PFL_4369: Ureidoglycolate hydrolase (EC 3.5.3.19) |
Gene: Pmen_2760: Ureidoglycolate hydrolase (EC 3.5.3.19) |
Gene: PST_3096: Ureidoglycolate hydrolase (EC 3.5.3.19) |
Gene: Avin_21100: Ureidoglycolate hydrolase (EC 3.5.3.19) |
Ureidoglycolate hydrolase (EC 3.5.3.19) |
| COG3748 |
Gene: PA1513: hypothetical protein, COG3748 |
Gene: PSEEN1682: hypothetical protein, COG3748 |
Gene: PP4289: hypothetical protein, COG3748 |
Gene: PSPTO3670: hypothetical protein, COG3748 |
Gene: PFL_4370: hypothetical protein, COG3748 |
Gene: Pmen_2761: hypothetical protein, COG3748 |
Gene: PST_3097: hypothetical protein, COG3748 |
Gene: Avin_21090: hypothetical protein, COG3748 |
hypothetical protein, COG3748 |
| pbuT2 |
Gene: PA1507: Xanthine/uracil permease |
Gene: PSEEN1681: Xanthine/uracil permease |
Gene: PP4290: Xanthine/uracil permease |
|
Gene: PFL_4371: Xanthine/uracil permease |
|
|
|
Xanthine/uracil permease |
| tsx2 |
|
Gene: PSEEN1680: Nucleoside-binding outer membrane protein |
Gene: PP4291: Nucleoside-binding outer membrane protein |
|
|
|
|
|
Nucleoside-binding outer membrane protein |
| CRON 6. | |||||||||
| pbuT2 |
|
|
|
|
Gene: PFL_3157: Xanthine/uracil permease |
*
Pseudomonas mendocina ymp Site: position = -100 score = 5.49641 sequence = TTCTGACCGACCAGACAGCT Gene: Pmen_2762: Xanthine/uracil permease |
|
|
Xanthine/uracil permease |
| tsx |
*
Pseudomonas aeruginosa PAO1 Site: position = -62 score = 5.76728 sequence = GCCTGACCGCTCGGACAGGT Gene: PA0165: Nucleoside-binding outer membrane protein |
*
Pseudomonas entomophila L48 Site: position = -349 score = 5.33518 sequence = ACCTGACCGAACGCCCAACT Site: position = -71 score = 5.23416 sequence = AGCTGACCCAAAAGACAAGA Site: position = -229 score = 5.15938 sequence = TACTGACCGCTCAGTCAATG Gene: PSEEN1679: Nucleoside-binding outer membrane protein |
*2
Pseudomonas putida KT2440 Site: position = -231 score = 5.15938 sequence = TACTGACCGCTCAGTCAATG Gene: PP4293: Nucleoside-binding outer membrane protein Gene: PP3214: Nucleoside-binding outer membrane protein |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -98 score = 5.38597 sequence = AGCTGACCAGACAGACAAAA Gene: PSPTO3671: Nucleoside-binding outer membrane protein |
*
Pseudomonas fluorescens Pf-5 Site: position = -253 score = 5.36276 sequence = ACCTGACCCAAGAGCCAACT Gene: PFL_4372: Nucleoside-binding outer membrane protein |
Gene: Pmen_2763: Nucleoside-binding outer membrane protein |
*2
Pseudomonas stutzeri A1501 Site: position = -58 score = 5.52839 sequence = GCCTGACCGCTTGGACAACT Site: position = -224 score = 5.10431 sequence = AGCTGACGCATCGGTCAGGT Gene: PST_2862: Nucleoside-binding outer membrane protein Gene: PST_3099: Nucleoside-binding outer membrane protein |
|
Nucleoside-binding outer membrane protein |
| CRON 7. | |||||||||
| pbuT3 |
Gene: PA1519: Xanthine/uracil permease |
*
Pseudomonas entomophila L48 Site: position = -121 score = 4.67418 sequence = TCCTGACCCAGAAGTCAACA Gene: PSEEN1759: Xanthine/uracil permease |
Gene: PP4284: Xanthine/uracil permease |
|
Gene: PFL_4364: Xanthine/uracil permease |
*
Pseudomonas mendocina ymp Site: position = -123 score = 4.76637 sequence = TCTTGACCGCTCGGTCAACA Gene: Pmen_2756: Xanthine/uracil permease |
*
Pseudomonas stutzeri A1501 Site: position = -63 score = 5.12352 sequence = TCCTGACCTTTCGGTCAACT Gene: PST_3090: Xanthine/uracil permease |
|
Xanthine/uracil permease |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |