Regulon of RutR in Pseudomonas stutzeri A1501

Properties
Regulator type:	Transcription factor
TF locus tag:	PST_2863
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 29 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Pseudomonadaceae
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -159 Score: 5.3 Sequence: ACCTGACCGAACAGACTACT Locus tag: PST_3175 Name: upp Funciton: Uracil phosphoribosyltransferase (EC 2.4.2.9) Locus tag: PST_3176 Name: uraA Funciton: Uracil permease
	PST_3175	upp	Uracil phosphoribosyltransferase (EC 2.4.2.9)
	PST_3176	uraA	Uracil permease
Position: -63 Score: 5.1 Sequence: TCCTGACCTTTCGGTCAACT Locus tag: PST_3090 Name: pbuT3 Funciton: Xanthine/uracil permease
	PST_3090	pbuT3	Xanthine/uracil permease
Position: -224 Score: 5.1 Sequence: AGCTGACGCATCGGTCAGGT Position: -58 Score: 5.5 Sequence: GCCTGACCGCTTGGACAACT Locus tag: PST_2862 Name: tsx Funciton: Nucleoside-binding outer membrane protein
	PST_2862	tsx	Nucleoside-binding outer membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD