Regulon of RutR in Pseudomonas syringae pv. tomato str. DC3000

Properties
Regulator type:	Transcription factor
TF locus tag:	PSPTO0771
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	12
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 29 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Pseudomonadaceae
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -98 Score: 5.4 Sequence: AGCTGACCAGACAGACAAAA Locus tag: PSPTO3671 Name: tsx Funciton: Nucleoside-binding outer membrane protein
	PSPTO3671	tsx	Nucleoside-binding outer membrane protein
Position: -169 Score: 6 Sequence: AACTGACCAGTCAGGCAGGT Locus tag: PSPTO3666 Name: COG0726 Funciton: putative polysaccharide deacetylase family protein Locus tag: PSPTO3667 Name: pucL Funciton: Uricase (EC 1.7.3.3) Locus tag: PSPTO3668 Name: allC Funciton: Allantoicase (EC 3.5.3.4) Locus tag: PSPTO3669 Name: allA Funciton: Ureidoglycolate hydrolase (EC 3.5.3.19) Locus tag: PSPTO3670 Name: COG3748 Funciton: hypothetical protein, COG3748
	PSPTO3666	COG0726	putative polysaccharide deacetylase family protein
	PSPTO3667	pucL	Uricase (EC 1.7.3.3)
	PSPTO3668	allC	Allantoicase (EC 3.5.3.4)
	PSPTO3669	allA	Ureidoglycolate hydrolase (EC 3.5.3.19)
	PSPTO3670	COG3748	hypothetical protein, COG3748
Position: -64 Score: 5.6 Sequence: ACCTGACCCATTGGCCAGGA Locus tag: PSPTO0769 Name: ppuA Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: PSPTO0768 Name: ppuC Funciton: Predicted ABC transporter, permease protein Locus tag: PSPTO0767 Name: ppuD Funciton: Predicted ABC transporter, inner membrane protein precursor
	PSPTO0769	ppuA	Predicted ABC transporter, ATP-binding protein
	PSPTO0768	ppuC	Predicted ABC transporter, permease protein
	PSPTO0767	ppuD	Predicted ABC transporter, inner membrane protein precursor
Position: -83 Score: 5.1 Sequence: ACCTGAGCAGGTGGACAGTT Locus tag: PSPTO0772 Name: pbuT Funciton: Xanthine/uracil permease Locus tag: PSPTO0771 Name: rutR Funciton: Transcriptional regulator RutR of pyrimidine catabolism, TetR family Locus tag: PSPTO0770 Name: COG1739 Funciton: hypothetical protein, COG1739
	PSPTO0772	pbuT	Xanthine/uracil permease
	PSPTO0771	rutR	Transcriptional regulator RutR of pyrimidine catabolism, TetR family
	PSPTO0770	COG1739	hypothetical protein, COG1739

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD