Regulon of RutR in Pseudomonas aeruginosa PAO1

Properties
Regulator type:	Transcription factor
TF locus tag:	PA0167
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	12
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 29 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Pseudomonadaceae
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -157 Score: 6 Sequence: AACTGACCAGTCGGGCAGGT Locus tag: PA1517 Name: COG0726 Funciton: putative polysaccharide deacetylase family protein Locus tag: PA1516 Name: pucL Funciton: Uricase (EC 1.7.3.3) Locus tag: PA1515 Name: allC Funciton: Allantoicase (EC 3.5.3.4) Locus tag: PA1514 Name: allA Funciton: Ureidoglycolate hydrolase (EC 3.5.3.19) Locus tag: PA1513 Name: COG3748 Funciton: hypothetical protein, COG3748
	PA1517	COG0726	putative polysaccharide deacetylase family protein
	PA1516	pucL	Uricase (EC 1.7.3.3)
	PA1515	allC	Allantoicase (EC 3.5.3.4)
	PA1514	allA	Ureidoglycolate hydrolase (EC 3.5.3.19)
	PA1513	COG3748	hypothetical protein, COG3748
Position: -65 Score: 5.4 Sequence: TCCTGACCTCCTGGCCAGGT Locus tag: PA0136 Name: ppuA Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: PA0137 Name: ppuC Funciton: Predicted ABC transporter, permease protein Locus tag: PA0138 Name: ppuD Funciton: Predicted ABC transporter, inner membrane protein precursor
	PA0136	ppuA	Predicted ABC transporter, ATP-binding protein
	PA0137	ppuC	Predicted ABC transporter, permease protein
	PA0138	ppuD	Predicted ABC transporter, inner membrane protein precursor
Position: -62 Score: 5.8 Sequence: GCCTGACCGCTCGGACAGGT Locus tag: PA0165 Name: tsx Funciton: Nucleoside-binding outer membrane protein
	PA0165	tsx	Nucleoside-binding outer membrane protein
Position: -77 Score: 5.3 Sequence: AGCTGATCACCTGGACAGCT Locus tag: PA0166 Name: pbuT Funciton: Xanthine/uracil permease Locus tag: PA0167 Name: rutR Funciton: Transcriptional regulator RutR of pyrimidine catabolism, TetR family Locus tag: PA0168 Name: COG1739 Funciton: hypothetical protein, COG1739
	PA0166	pbuT	Xanthine/uracil permease
	PA0167	rutR	Transcriptional regulator RutR of pyrimidine catabolism, TetR family
	PA0168	COG1739	hypothetical protein, COG1739

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD