Regulon of RutR in Pseudomonas entomophila L48

Properties
Regulator type:	Transcription factor
TF locus tag:	PSEEN0679
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	8
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 29 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Pseudomonadaceae
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -179 Score: 6 Sequence: AACTGACCAATCGGGCAAGT Locus tag: PSEEN1685 Name: COG0726 Funciton: putative polysaccharide deacetylase family protein Locus tag: PSEEN1684 Name: pucL Funciton: Uricase (EC 1.7.3.3) Locus tag: PSEEN1683 Name: allA Funciton: Ureidoglycolate hydrolase (EC 3.5.3.19) Locus tag: PSEEN1682 Name: COG3748 Funciton: hypothetical protein, COG3748 Locus tag: PSEEN1681 Name: pbuT2 Funciton: Xanthine/uracil permease Locus tag: PSEEN1680 Name: tsx2 Funciton: Nucleoside-binding outer membrane protein
	PSEEN1685	COG0726	putative polysaccharide deacetylase family protein
	PSEEN1684	pucL	Uricase (EC 1.7.3.3)
	PSEEN1683	allA	Ureidoglycolate hydrolase (EC 3.5.3.19)
	PSEEN1682	COG3748	hypothetical protein, COG3748
	PSEEN1681	pbuT2	Xanthine/uracil permease
	PSEEN1680	tsx2	Nucleoside-binding outer membrane protein
Position: -121 Score: 4.7 Sequence: TCCTGACCCAGAAGTCAACA Locus tag: PSEEN1759 Name: pbuT3 Funciton: Xanthine/uracil permease
	PSEEN1759	pbuT3	Xanthine/uracil permease
Position: -349 Score: 5.3 Sequence: ACCTGACCGAACGCCCAACT Position: -229 Score: 5.2 Sequence: TACTGACCGCTCAGTCAATG Position: -71 Score: 5.2 Sequence: AGCTGACCCAAAAGACAAGA Locus tag: PSEEN1679 Name: tsx Funciton: Nucleoside-binding outer membrane protein
	PSEEN1679	tsx	Nucleoside-binding outer membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD