Regulon of RutR in Pseudomonas mendocina ymp

Properties
Regulator type:	Transcription factor
TF locus tag:	Pmen_3699
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	12
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 29 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Pseudomonadaceae
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -92 Score: 5.4 Sequence: AGCTGATCAGTTGGACAGCT Position: -54 Score: 5.7 Sequence: ACCTGACCACACGGCCAGGA Locus tag: Pmen_3697 Name: tsx3 Funciton: Nucleoside-binding outer membrane protein Locus tag: Pmen_3698 Name: pbuT Funciton: Xanthine/uracil permease Locus tag: Pmen_3699 Name: rutR Funciton: Transcriptional regulator RutR of pyrimidine catabolism, TetR family Locus tag: Pmen_3700 Name: COG1739 Funciton: hypothetical protein, COG1739
	Pmen_3697	tsx3	Nucleoside-binding outer membrane protein
	Pmen_3698	pbuT	Xanthine/uracil permease
	Pmen_3699	rutR	Transcriptional regulator RutR of pyrimidine catabolism, TetR family
	Pmen_3700	COG1739	hypothetical protein, COG1739
Position: -166 Score: 5.8 Sequence: TGCTGACCACTCAGGCAATT Locus tag: Pmen_2758 Name: COG0726 Funciton: putative polysaccharide deacetylase family protein Locus tag: Pmen_2759 Name: pucL Funciton: Uricase (EC 1.7.3.3) Locus tag: Pmen_2760 Name: allA Funciton: Ureidoglycolate hydrolase (EC 3.5.3.19) Locus tag: Pmen_2761 Name: COG3748 Funciton: hypothetical protein, COG3748
	Pmen_2758	COG0726	putative polysaccharide deacetylase family protein
	Pmen_2759	pucL	Uricase (EC 1.7.3.3)
	Pmen_2760	allA	Ureidoglycolate hydrolase (EC 3.5.3.19)
	Pmen_2761	COG3748	hypothetical protein, COG3748
Position: -36 Score: 5.6 Sequence: GCCTGACCAATCGGACAACA Locus tag: Pmen_4444 Name: pbuT4 Funciton: Xanthine/uracil permease
	Pmen_4444	pbuT4	Xanthine/uracil permease
Position: -100 Score: 5.5 Sequence: TTCTGACCGACCAGACAGCT Locus tag: Pmen_2762 Name: pbuT2 Funciton: Xanthine/uracil permease Locus tag: Pmen_2763 Name: tsx Funciton: Nucleoside-binding outer membrane protein
	Pmen_2762	pbuT2	Xanthine/uracil permease
	Pmen_2763	tsx	Nucleoside-binding outer membrane protein
Position: -123 Score: 4.8 Sequence: TCTTGACCGCTCGGTCAACA Locus tag: Pmen_2756 Name: pbuT3 Funciton: Xanthine/uracil permease
	Pmen_2756	pbuT3	Xanthine/uracil permease

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD