Regulon of RutR in Pseudomonas putida KT2440

Properties
Regulator type:	Transcription factor
TF locus tag:	PP0594
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 29 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Pseudomonadaceae
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -189 Score: 6 Sequence: AGCTGACCAAACAGGCAGGT Locus tag: PP4286 Name: COG0726 Funciton: putative polysaccharide deacetylase family protein Locus tag: PP4287 Name: pucL Funciton: Uricase (EC 1.7.3.3) Locus tag: PP4288 Name: allA Funciton: Ureidoglycolate hydrolase (EC 3.5.3.19) Locus tag: PP4289 Name: COG3748 Funciton: hypothetical protein, COG3748 Locus tag: PP4290 Name: pbuT2 Funciton: Xanthine/uracil permease Locus tag: PP4291 Name: tsx2 Funciton: Nucleoside-binding outer membrane protein
	PP4286	COG0726	putative polysaccharide deacetylase family protein
	PP4287	pucL	Uricase (EC 1.7.3.3)
	PP4288	allA	Ureidoglycolate hydrolase (EC 3.5.3.19)
	PP4289	COG3748	hypothetical protein, COG3748
	PP4290	pbuT2	Xanthine/uracil permease
	PP4291	tsx2	Nucleoside-binding outer membrane protein
Position: -231 Score: 5.2 Sequence: TACTGACCGCTCAGTCAATG Locus tag: PP4293 Name: tsx Funciton: Nucleoside-binding outer membrane protein
	PP4293	tsx	Nucleoside-binding outer membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD