Regulog PsrA - Pseudomonadaceae

Properties
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Fatty acid degradation
Effector:	Oleate
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 69 sites [see more]

Member of regulog collections

By trascription factor - PsrA
By taxonomy - Pseudomonadaceae
By TF family - TetR
By effector - Oleate
By pathway - Fatty acid degradation

Statistics of regulated genes
Genome	Genes	Operons
Pseudomonas aeruginosa PAO1	13	8
Pseudomonas entomophila L48	13	10
Pseudomonas putida KT2440	13	10
Pseudomonas syringae pv. tomato str. DC3000	11	8
Pseudomonas fluorescens Pf-5	12	9
Pseudomonas mendocina ymp	11	8
Pseudomonas stutzeri A1501	10	7
Azotobacter vinelandii AvOP	1	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes									Function

CRON 1.
acdH1	* Pseudomonas aeruginosa PAO1 Site: position = -139 score = 5.53238 sequence = TTTCAAACGCCTGTTTGAGA Gene: PA0506: probable acyl-CoA dehydrogenase	* Pseudomonas entomophila L48 Site: position = -87 score = 5.74221 sequence = TTTCAAACAACTGTTTGACC Gene: PSEEN5115: probable acyl-CoA dehydrogenase	* Pseudomonas putida KT2440 Site: position = -73 score = 5.76969 sequence = TTTCAAACAACTGTTTGATC Gene: PP0368: probable acyl-CoA dehydrogenase	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -113 score = 5.64499 sequence = TTTCAAACACCTGTTTGACC Gene: PSPTO0500: probable acyl-CoA dehydrogenase	* Pseudomonas fluorescens Pf-5 Site: position = -78 score = 5.74221 sequence = TTTCAAACAACTGTTTGACC Gene: PFL_5687: probable acyl-CoA dehydrogenase	* Pseudomonas mendocina ymp Site: position = -125 score = 5.8922 sequence = TTTCAAACGCCTGTTTGATT Gene: Pmen_4081: probable acyl-CoA dehydrogenase	* Pseudomonas stutzeri A1501 Site: position = -71 score = 4.72076 sequence = GTCGAAACGTATGTTTCAAA Site: position = -58 score = 5.69898 sequence = TTTCAAACGCCTGTTTGACC Gene: PST_3860: probable acyl-CoA dehydrogenase	Azotobacter vinelandii AvOP Gene: Avin_45920: probable acyl-CoA dehydrogenase	probable acyl-CoA dehydrogenase
acdH2	Pseudomonas aeruginosa PAO1 Gene: PA0507: Acyl-CoA dehydrogenase (EC 1.3.99.3)	Pseudomonas entomophila L48	Pseudomonas putida KT2440	Pseudomonas syringae pv. tomato str. DC3000	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	Pseudomonas stutzeri A1501	Azotobacter vinelandii AvOP	Acyl-CoA dehydrogenase (EC 1.3.99.3)
acdH3	Pseudomonas aeruginosa PAO1 Gene: PA0508: Acyl-CoA dehydrogenase (EC 1.3.99.3)	Pseudomonas entomophila L48	Pseudomonas putida KT2440	Pseudomonas syringae pv. tomato str. DC3000	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	Pseudomonas stutzeri A1501	Azotobacter vinelandii AvOP	Acyl-CoA dehydrogenase (EC 1.3.99.3)

CRON 2.
PA1831	* Pseudomonas aeruginosa PAO1 Site: position = -84 score = 5.66777 sequence = ATTCAAACAAGCGTATGTTT Gene: PA1831: Phosphoglycerate mutase family protein	* Pseudomonas entomophila L48 Site: position = -99 score = 5.19022 sequence = GTTCAAACGACCTTTTCAAA Site: position = -86 score = 5.65247 sequence = TTTCAAACGCTTGTATGTTT Gene: PSEEN2270: Phosphoglycerate mutase family protein	* Pseudomonas putida KT2440 Site: position = -98 score = 5.29054 sequence = TTTCAAACAACCTTTTCAAA Site: position = -85 score = 5.65247 sequence = TTTCAAACGCTTGTATGTTT Gene: PP3923: Phosphoglycerate mutase family protein	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -89 score = 5.75435 sequence = TTTCAAACGAGCGTATGTTT Gene: PSPTO2726: Phosphoglycerate mutase family protein	* Pseudomonas fluorescens Pf-5 Site: position = -88 score = 5.70036 sequence = TTTCAAACAAGCGTATGTTT Gene: PFL_3668: Phosphoglycerate mutase family protein	* Pseudomonas mendocina ymp Site: position = -89 score = 5.66777 sequence = ATTCAAACAAGCGTATGTTT Gene: Pmen_2531: Phosphoglycerate mutase family protein	* Pseudomonas stutzeri A1501 Site: position = -146 score = 5.5501 sequence = ATTCAAACAAACGTTCGAAT Gene: PST_2241: Phosphoglycerate mutase family protein	Azotobacter vinelandii AvOP Gene: Avin_27570: Phosphoglycerate mutase family protein	Phosphoglycerate mutase family protein
scp	Pseudomonas aeruginosa PAO1 Gene: PA1830: Sterol-binding domain protein	Pseudomonas entomophila L48 Gene: PSEEN2269: Sterol-binding domain protein	Pseudomonas putida KT2440 Gene: PP3924: Sterol-binding domain protein	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO2725: Sterol-binding domain protein	Pseudomonas fluorescens Pf-5 Gene: PFL_3669: Sterol-binding domain protein	Pseudomonas mendocina ymp Gene: Pmen_2532: Sterol-binding domain protein	Pseudomonas stutzeri A1501 Gene: PST_2242: Sterol-binding domain protein	Azotobacter vinelandii AvOP Gene: Avin_27580: Sterol-binding domain protein	Sterol-binding domain protein

CRON 3.
fadH	Pseudomonas aeruginosa PAO1 Gene: PA3092: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)	* Pseudomonas entomophila L48 Site: position = -102 score = 4.90479 sequence = GTTCAAACGCCTGTTTAATG Gene: PSEEN1703: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)	* Pseudomonas putida KT2440 Site: position = -54 score = 4.97544 sequence = ATTCAAACGGCTGTTTAATG Gene: PP2008: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO3803: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)	Pseudomonas fluorescens Pf-5 Gene: PFL_3969: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)	Pseudomonas mendocina ymp Gene: Pmen_2951: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)	Pseudomonas stutzeri A1501 Gene: PST_1812: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)	Azotobacter vinelandii AvOP	2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)

CRON 4.
etfD	* Pseudomonas aeruginosa PAO1 Site: position = -122 score = 5.90565 sequence = ATTCAAACAAACGTTTGTAT Gene: PA2953: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)	* Pseudomonas entomophila L48 Site: position = -153 score = 5.90565 sequence = ATTCAAACAAACGTTTGTAT Gene: PSEEN3660: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)	* Pseudomonas putida KT2440 Site: position = -163 score = 5.90565 sequence = ATTCAAACAAACGTTTGTAT Gene: PP4203: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)	Pseudomonas syringae pv. tomato str. DC3000	* Pseudomonas fluorescens Pf-5 Site: position = -176 score = 5.90565 sequence = ATTCAAACAAACGTTTGTAT Gene: PFL_1818: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)	* Pseudomonas mendocina ymp Site: position = -123 score = 5.90565 sequence = ATTCAAACAAACGTTTGTAT Gene: Pmen_2708: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)	* Pseudomonas stutzeri A1501 Site: position = -130 score = 5.90565 sequence = ATTCAAACAAACGTTTGTAT Gene: PST_2607: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)	3 Azotobacter vinelandii AvOP Gene: Avin_17400: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) Gene: Avin_15160: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) Gene: Avin_16430: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)	Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)

CRON 5.
rpoS	* Pseudomonas aeruginosa PAO1 Site: position = -427 score = 4.76789 sequence = CCTCAAACGGAAGTTTGAAT Gene: PA3622: RNA polymerase sigma factor RpoS	* Pseudomonas entomophila L48 Site: position = -428 score = 5.10652 sequence = CTTCAAACGGTAGTTTGAAT Gene: PSEEN4189: RNA polymerase sigma factor RpoS	* Pseudomonas putida KT2440 Site: position = -431 score = 5.10652 sequence = CTTCAAACGGTAGTTTGAAT Gene: PP1623: RNA polymerase sigma factor RpoS	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -427 score = 4.77927 sequence = CCTCAAACGGCAGTTTGAAT Gene: PSPTO1565: RNA polymerase sigma factor RpoS	* Pseudomonas fluorescens Pf-5 Site: position = -429 score = 5.10652 sequence = CTTCAAACGGTAGTTTGAAT Gene: PFL_1207: RNA polymerase sigma factor RpoS	* Pseudomonas mendocina ymp Site: position = -424 score = 4.78992 sequence = CCTCAAACGGTAGTTTGAAT Gene: Pmen_3020: RNA polymerase sigma factor RpoS	* Pseudomonas stutzeri A1501 Site: position = -421 score = 4.78992 sequence = CCTCAAACGGTAGTTTGAAT Gene: PST_1572: RNA polymerase sigma factor RpoS	* Azotobacter vinelandii AvOP Site: position = -422 score = 4.77927 sequence = CCTCAAACGGCAGTTTGAAT Gene: Avin_38680: RNA polymerase sigma factor RpoS	RNA polymerase sigma factor RpoS

CRON 6.
algQ	* Pseudomonas aeruginosa PAO1 Site: position = -196 score = 5.50388 sequence = GATCAAACATCCGTATGAAT Gene: PA5255: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ	* Pseudomonas entomophila L48 Site: position = -182 score = 5.12893 sequence = GATTAAACGCTTGTATGAAC Gene: PSEEN0159: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ	* Pseudomonas putida KT2440 Site: position = -182 score = 5.22925 sequence = TATTAAACACTTGTATGAAC Gene: PP0191: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -180 score = 5.28324 sequence = TATTAAACGCTTGTATGAAC Gene: PSPTO0134: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ	* Pseudomonas fluorescens Pf-5 Site: position = -183 score = 5.12893 sequence = GATTAAACGCTTGTATGAAC Gene: PFL_5997: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ	* Pseudomonas mendocina ymp Site: position = -269 score = 5.20337 sequence = GATTAAACGCTCGTATGAAA Gene: Pmen_0285: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ	Pseudomonas stutzeri A1501 Gene: PST_0529: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ	Azotobacter vinelandii AvOP Gene: Avin_47550: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ	Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ

CRON 7.
fadB	* Pseudomonas aeruginosa PAO1 Site: position = -180 score = 5.50878 sequence = AGTCAAACGGGCGTATGAAT Gene: PA3014: Enoyl-CoA hydratase (EC 4.2.1.17)	* Pseudomonas entomophila L48 Site: position = -162 score = 5.7128 sequence = AATCAAACGGGCGTATGAAT Gene: PSEEN3728: Enoyl-CoA hydratase (EC 4.2.1.17)	* Pseudomonas putida KT2440 Site: position = -161 score = 5.7128 sequence = AATCAAACGGGCGTATGAAT Gene: PP2136: Enoyl-CoA hydratase (EC 4.2.1.17)	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -180 score = 5.6537 sequence = AATCAAACGGGCGTATGAAA Gene: PSPTO3517: Enoyl-CoA hydratase (EC 4.2.1.17)	* Pseudomonas fluorescens Pf-5 Site: position = -180 score = 5.6537 sequence = AATCAAACGGGCGTATGAAA Gene: PFL_1940: Enoyl-CoA hydratase (EC 4.2.1.17)	* Pseudomonas mendocina ymp Site: position = -178 score = 5.7128 sequence = AATCAAACGGGCGTATGAAT Gene: Pmen_1580: Enoyl-CoA hydratase (EC 4.2.1.17)	* Pseudomonas stutzeri A1501 Site: position = -155 score = 5.7128 sequence = AATCAAACGGGCGTATGAAT Gene: PST_1726: Enoyl-CoA hydratase (EC 4.2.1.17)	Azotobacter vinelandii AvOP Gene: Avin_14440: Enoyl-CoA hydratase (EC 4.2.1.17)	Enoyl-CoA hydratase (EC 4.2.1.17)
fadA	Pseudomonas aeruginosa PAO1 Gene: PA3013: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)	Pseudomonas entomophila L48 Gene: PSEEN3727: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)	Pseudomonas putida KT2440 Gene: PP2137: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO3516: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)	Pseudomonas fluorescens Pf-5 Gene: PFL_1941: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)	Pseudomonas mendocina ymp Gene: Pmen_1581: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)	Pseudomonas stutzeri A1501 Gene: PST_1727: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)	Azotobacter vinelandii AvOP Gene: Avin_14450: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)	3-ketoacyl-CoA thiolase (EC 2.3.1.16)

CRON 8.
PSEEN3648	Pseudomonas aeruginosa PAO1	* Pseudomonas entomophila L48 Site: position = -72 score = 5.37759 sequence = TTTCAAACGTATGTTTGAGC Gene: PSEEN3648: Proteinase inhibitor	* Pseudomonas putida KT2440 Site: position = -83 score = 5.52294 sequence = TTTCAAACGACTGTTTGAGC Gene: PP4195: Proteinase inhibitor	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -68 score = 4.78571 sequence = TTTCAAACAAACGTTTTGAC Gene: PSPTO2192: Proteinase inhibitor	* Pseudomonas fluorescens Pf-5 Site: position = -76 score = 4.51138 sequence = TTTTAAACGGCTGTTTTAGC Gene: PFL_1826: Proteinase inhibitor	Pseudomonas mendocina ymp Gene: Pmen_2510: Proteinase inhibitor	Pseudomonas stutzeri A1501	Azotobacter vinelandii AvOP Gene: Avin_29830: Proteinase inhibitor	Proteinase inhibitor

CRON 9.
psrA	* Pseudomonas aeruginosa PAO1 Site: position = -45 score = 4.95268 sequence = GCTGAAACGTATGTTTCAAA Site: position = -32 score = 5.76096 sequence = TTTCAAACAAGTGTTTGTCA Gene: PA3006: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family	* Pseudomonas entomophila L48 Site: position = -45 score = 4.74262 sequence = CCTGAAACGTATGTTTCAAA Site: position = -32 score = 5.71344 sequence = TTTCAAACAACTGTTTGTCA Gene: PSEEN3720: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family	* Pseudomonas putida KT2440 Site: position = -54 score = 4.95268 sequence = GCTGAAACGTATGTTTCAAA Site: position = -41 score = 5.67532 sequence = TTTCAAACACCTGTTTGTCT Gene: PP2144: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -31 score = 5.63936 sequence = TTTCAAACGTTCGTTTGTTA Gene: PSPTO3508: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family	* Pseudomonas fluorescens Pf-5 Site: position = -45 score = 4.74262 sequence = CCTGAAACGTATGTTTCAAA Site: position = -32 score = 5.76096 sequence = TTTCAAACAAGTGTTTGTCA Gene: PFL_1950: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family	* Pseudomonas mendocina ymp Site: position = -44 score = 4.95268 sequence = GCTGAAACGTATGTTTCAAA Site: position = -31 score = 5.76096 sequence = TTTCAAACAAGTGTTTGTCA Gene: Pmen_1588: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family	* Pseudomonas stutzeri A1501 Site: position = -32 score = 5.63491 sequence = TTTCAAACAGTTGTTTGTCT Gene: PST_1735: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family	Azotobacter vinelandii AvOP Gene: Avin_14520: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family	Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family

CRON 10.
etfB	* Pseudomonas aeruginosa PAO1 Site: position = -218 score = 5.57571 sequence = ATACAAACGTTTGTTTGAAT Gene: PA2952: Electron transfer flavoprotein, beta subunit	* Pseudomonas entomophila L48 Site: position = -391 score = 5.57571 sequence = ATACAAACGTTTGTTTGAAT Gene: PSEEN3658: Electron transfer flavoprotein, beta subunit	* Pseudomonas putida KT2440 Site: position = -392 score = 5.57571 sequence = ATACAAACGTTTGTTTGAAT Gene: PP4202: Electron transfer flavoprotein, beta subunit	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -373 score = 5.57571 sequence = ATACAAACGTTTGTTTGAAT Gene: PSPTO2185: Electron transfer flavoprotein, beta subunit	* Pseudomonas fluorescens Pf-5 Site: position = -393 score = 5.57571 sequence = ATACAAACGTTTGTTTGAAT Gene: PFL_1819: Electron transfer flavoprotein, beta subunit	* Pseudomonas mendocina ymp Site: position = -221 score = 5.57571 sequence = ATACAAACGTTTGTTTGAAT Gene: Pmen_2707: Electron transfer flavoprotein, beta subunit	* Pseudomonas stutzeri A1501 Site: position = -323 score = 5.57571 sequence = ATACAAACGTTTGTTTGAAT Gene: PST_2605: Electron transfer flavoprotein, beta subunit	2 Azotobacter vinelandii AvOP Gene: Avin_15180: Electron transfer flavoprotein, beta subunit Gene: Avin_14280: Electron transfer flavoprotein, beta subunit	Electron transfer flavoprotein, beta subunit
etfA	Pseudomonas aeruginosa PAO1 Gene: PA2951: Electron transfer flavoprotein, alpha subunit	Pseudomonas entomophila L48 Gene: PSEEN3657: Electron transfer flavoprotein, alpha subunit	Pseudomonas putida KT2440 Gene: PP4201: Electron transfer flavoprotein, alpha subunit	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO2186: Electron transfer flavoprotein, alpha subunit	Pseudomonas fluorescens Pf-5 Gene: PFL_1820: Electron transfer flavoprotein, alpha subunit	Pseudomonas mendocina ymp Gene: Pmen_2706: Electron transfer flavoprotein, alpha subunit	Pseudomonas stutzeri A1501 Gene: PST_2604: Electron transfer flavoprotein, alpha subunit	2 Azotobacter vinelandii AvOP Gene: Avin_15190: Electron transfer flavoprotein, alpha subunit Gene: Avin_14290: Electron transfer flavoprotein, alpha subunit	Electron transfer flavoprotein, alpha subunit

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog PsrA - Pseudomonadaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --