Regulog PsrA - Pseudomonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - PsrA
- By taxonomy - Pseudomonadaceae
- By TF family - TetR
- By effector - Oleate
- By pathway - Fatty acid degradation
| Genome | Genes | Operons |
|---|---|---|
| Pseudomonas aeruginosa PAO1 | 13 | 8 |
| Pseudomonas entomophila L48 | 13 | 10 |
| Pseudomonas putida KT2440 | 13 | 10 |
| Pseudomonas syringae pv. tomato str. DC3000 | 11 | 8 |
| Pseudomonas fluorescens Pf-5 | 12 | 9 |
| Pseudomonas mendocina ymp | 11 | 8 |
| Pseudomonas stutzeri A1501 | 10 | 7 |
| Azotobacter vinelandii AvOP | 1 | 1 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| acdH1 |
*
Pseudomonas aeruginosa PAO1 Site: position = -139 score = 5.53238 sequence = TTTCAAACGCCTGTTTGAGA Gene: PA0506: probable acyl-CoA dehydrogenase |
*
Pseudomonas entomophila L48 Site: position = -87 score = 5.74221 sequence = TTTCAAACAACTGTTTGACC Gene: PSEEN5115: probable acyl-CoA dehydrogenase |
*
Pseudomonas putida KT2440 Site: position = -73 score = 5.76969 sequence = TTTCAAACAACTGTTTGATC Gene: PP0368: probable acyl-CoA dehydrogenase |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -113 score = 5.64499 sequence = TTTCAAACACCTGTTTGACC Gene: PSPTO0500: probable acyl-CoA dehydrogenase |
*
Pseudomonas fluorescens Pf-5 Site: position = -78 score = 5.74221 sequence = TTTCAAACAACTGTTTGACC Gene: PFL_5687: probable acyl-CoA dehydrogenase |
*
Pseudomonas mendocina ymp Site: position = -125 score = 5.8922 sequence = TTTCAAACGCCTGTTTGATT Gene: Pmen_4081: probable acyl-CoA dehydrogenase |
*
Pseudomonas stutzeri A1501 Site: position = -71 score = 4.72076 sequence = GTCGAAACGTATGTTTCAAA Site: position = -58 score = 5.69898 sequence = TTTCAAACGCCTGTTTGACC Gene: PST_3860: probable acyl-CoA dehydrogenase |
Gene: Avin_45920: probable acyl-CoA dehydrogenase |
probable acyl-CoA dehydrogenase |
| acdH2 |
Gene: PA0507: Acyl-CoA dehydrogenase (EC 1.3.99.3) |
|
|
|
|
|
|
|
Acyl-CoA dehydrogenase (EC 1.3.99.3) |
| acdH3 |
Gene: PA0508: Acyl-CoA dehydrogenase (EC 1.3.99.3) |
|
|
|
|
|
|
|
Acyl-CoA dehydrogenase (EC 1.3.99.3) |
| CRON 2. | |||||||||
| PA1831 |
*
Pseudomonas aeruginosa PAO1 Site: position = -84 score = 5.66777 sequence = ATTCAAACAAGCGTATGTTT Gene: PA1831: Phosphoglycerate mutase family protein |
*
Pseudomonas entomophila L48 Site: position = -99 score = 5.19022 sequence = GTTCAAACGACCTTTTCAAA Site: position = -86 score = 5.65247 sequence = TTTCAAACGCTTGTATGTTT Gene: PSEEN2270: Phosphoglycerate mutase family protein |
*
Pseudomonas putida KT2440 Site: position = -98 score = 5.29054 sequence = TTTCAAACAACCTTTTCAAA Site: position = -85 score = 5.65247 sequence = TTTCAAACGCTTGTATGTTT Gene: PP3923: Phosphoglycerate mutase family protein |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -89 score = 5.75435 sequence = TTTCAAACGAGCGTATGTTT Gene: PSPTO2726: Phosphoglycerate mutase family protein |
*
Pseudomonas fluorescens Pf-5 Site: position = -88 score = 5.70036 sequence = TTTCAAACAAGCGTATGTTT Gene: PFL_3668: Phosphoglycerate mutase family protein |
*
Pseudomonas mendocina ymp Site: position = -89 score = 5.66777 sequence = ATTCAAACAAGCGTATGTTT Gene: Pmen_2531: Phosphoglycerate mutase family protein |
*
Pseudomonas stutzeri A1501 Site: position = -146 score = 5.5501 sequence = ATTCAAACAAACGTTCGAAT Gene: PST_2241: Phosphoglycerate mutase family protein |
Gene: Avin_27570: Phosphoglycerate mutase family protein |
Phosphoglycerate mutase family protein |
| scp |
Gene: PA1830: Sterol-binding domain protein |
Gene: PSEEN2269: Sterol-binding domain protein |
Gene: PP3924: Sterol-binding domain protein |
Gene: PSPTO2725: Sterol-binding domain protein |
Gene: PFL_3669: Sterol-binding domain protein |
Gene: Pmen_2532: Sterol-binding domain protein |
Gene: PST_2242: Sterol-binding domain protein |
Gene: Avin_27580: Sterol-binding domain protein |
Sterol-binding domain protein |
| CRON 3. | |||||||||
| fadH |
Gene: PA3092: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34) |
*
Pseudomonas entomophila L48 Site: position = -102 score = 4.90479 sequence = GTTCAAACGCCTGTTTAATG Gene: PSEEN1703: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34) |
*
Pseudomonas putida KT2440 Site: position = -54 score = 4.97544 sequence = ATTCAAACGGCTGTTTAATG Gene: PP2008: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34) |
Gene: PSPTO3803: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34) |
Gene: PFL_3969: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34) |
Gene: Pmen_2951: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34) |
Gene: PST_1812: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34) |
|
2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34) |
| CRON 4. | |||||||||
| etfD |
*
Pseudomonas aeruginosa PAO1 Site: position = -122 score = 5.90565 sequence = ATTCAAACAAACGTTTGTAT Gene: PA2953: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
*
Pseudomonas entomophila L48 Site: position = -153 score = 5.90565 sequence = ATTCAAACAAACGTTTGTAT Gene: PSEEN3660: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
*
Pseudomonas putida KT2440 Site: position = -163 score = 5.90565 sequence = ATTCAAACAAACGTTTGTAT Gene: PP4203: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
|
*
Pseudomonas fluorescens Pf-5 Site: position = -176 score = 5.90565 sequence = ATTCAAACAAACGTTTGTAT Gene: PFL_1818: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
*
Pseudomonas mendocina ymp Site: position = -123 score = 5.90565 sequence = ATTCAAACAAACGTTTGTAT Gene: Pmen_2708: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
*
Pseudomonas stutzeri A1501 Site: position = -130 score = 5.90565 sequence = ATTCAAACAAACGTTTGTAT Gene: PST_2607: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
3
Azotobacter vinelandii AvOP Gene: Avin_17400: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) Gene: Avin_15160: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) Gene: Avin_16430: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
| CRON 5. | |||||||||
| rpoS |
*
Pseudomonas aeruginosa PAO1 Site: position = -427 score = 4.76789 sequence = CCTCAAACGGAAGTTTGAAT Gene: PA3622: RNA polymerase sigma factor RpoS |
*
Pseudomonas entomophila L48 Site: position = -428 score = 5.10652 sequence = CTTCAAACGGTAGTTTGAAT Gene: PSEEN4189: RNA polymerase sigma factor RpoS |
*
Pseudomonas putida KT2440 Site: position = -431 score = 5.10652 sequence = CTTCAAACGGTAGTTTGAAT Gene: PP1623: RNA polymerase sigma factor RpoS |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -427 score = 4.77927 sequence = CCTCAAACGGCAGTTTGAAT Gene: PSPTO1565: RNA polymerase sigma factor RpoS |
*
Pseudomonas fluorescens Pf-5 Site: position = -429 score = 5.10652 sequence = CTTCAAACGGTAGTTTGAAT Gene: PFL_1207: RNA polymerase sigma factor RpoS |
*
Pseudomonas mendocina ymp Site: position = -424 score = 4.78992 sequence = CCTCAAACGGTAGTTTGAAT Gene: Pmen_3020: RNA polymerase sigma factor RpoS |
*
Pseudomonas stutzeri A1501 Site: position = -421 score = 4.78992 sequence = CCTCAAACGGTAGTTTGAAT Gene: PST_1572: RNA polymerase sigma factor RpoS |
*
Azotobacter vinelandii AvOP Site: position = -422 score = 4.77927 sequence = CCTCAAACGGCAGTTTGAAT Gene: Avin_38680: RNA polymerase sigma factor RpoS |
RNA polymerase sigma factor RpoS |
| CRON 6. | |||||||||
| algQ |
*
Pseudomonas aeruginosa PAO1 Site: position = -196 score = 5.50388 sequence = GATCAAACATCCGTATGAAT Gene: PA5255: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ |
*
Pseudomonas entomophila L48 Site: position = -182 score = 5.12893 sequence = GATTAAACGCTTGTATGAAC Gene: PSEEN0159: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ |
*
Pseudomonas putida KT2440 Site: position = -182 score = 5.22925 sequence = TATTAAACACTTGTATGAAC Gene: PP0191: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -180 score = 5.28324 sequence = TATTAAACGCTTGTATGAAC Gene: PSPTO0134: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ |
*
Pseudomonas fluorescens Pf-5 Site: position = -183 score = 5.12893 sequence = GATTAAACGCTTGTATGAAC Gene: PFL_5997: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ |
*
Pseudomonas mendocina ymp Site: position = -269 score = 5.20337 sequence = GATTAAACGCTCGTATGAAA Gene: Pmen_0285: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ |
Gene: PST_0529: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ |
Gene: Avin_47550: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ |
Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ |
| CRON 7. | |||||||||
| fadB |
*
Pseudomonas aeruginosa PAO1 Site: position = -180 score = 5.50878 sequence = AGTCAAACGGGCGTATGAAT Gene: PA3014: Enoyl-CoA hydratase (EC 4.2.1.17) |
*
Pseudomonas entomophila L48 Site: position = -162 score = 5.7128 sequence = AATCAAACGGGCGTATGAAT Gene: PSEEN3728: Enoyl-CoA hydratase (EC 4.2.1.17) |
*
Pseudomonas putida KT2440 Site: position = -161 score = 5.7128 sequence = AATCAAACGGGCGTATGAAT Gene: PP2136: Enoyl-CoA hydratase (EC 4.2.1.17) |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -180 score = 5.6537 sequence = AATCAAACGGGCGTATGAAA Gene: PSPTO3517: Enoyl-CoA hydratase (EC 4.2.1.17) |
*
Pseudomonas fluorescens Pf-5 Site: position = -180 score = 5.6537 sequence = AATCAAACGGGCGTATGAAA Gene: PFL_1940: Enoyl-CoA hydratase (EC 4.2.1.17) |
*
Pseudomonas mendocina ymp Site: position = -178 score = 5.7128 sequence = AATCAAACGGGCGTATGAAT Gene: Pmen_1580: Enoyl-CoA hydratase (EC 4.2.1.17) |
*
Pseudomonas stutzeri A1501 Site: position = -155 score = 5.7128 sequence = AATCAAACGGGCGTATGAAT Gene: PST_1726: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: Avin_14440: Enoyl-CoA hydratase (EC 4.2.1.17) |
Enoyl-CoA hydratase (EC 4.2.1.17) |
| fadA |
Gene: PA3013: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
Gene: PSEEN3727: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
Gene: PP2137: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
Gene: PSPTO3516: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
Gene: PFL_1941: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
Gene: Pmen_1581: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
Gene: PST_1727: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
Gene: Avin_14450: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
| CRON 8. | |||||||||
| PSEEN3648 |
|
*
Pseudomonas entomophila L48 Site: position = -72 score = 5.37759 sequence = TTTCAAACGTATGTTTGAGC Gene: PSEEN3648: Proteinase inhibitor |
*
Pseudomonas putida KT2440 Site: position = -83 score = 5.52294 sequence = TTTCAAACGACTGTTTGAGC Gene: PP4195: Proteinase inhibitor |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -68 score = 4.78571 sequence = TTTCAAACAAACGTTTTGAC Gene: PSPTO2192: Proteinase inhibitor |
*
Pseudomonas fluorescens Pf-5 Site: position = -76 score = 4.51138 sequence = TTTTAAACGGCTGTTTTAGC Gene: PFL_1826: Proteinase inhibitor |
Gene: Pmen_2510: Proteinase inhibitor |
|
Gene: Avin_29830: Proteinase inhibitor |
Proteinase inhibitor |
| CRON 9. | |||||||||
| psrA |
*
Pseudomonas aeruginosa PAO1 Site: position = -45 score = 4.95268 sequence = GCTGAAACGTATGTTTCAAA Site: position = -32 score = 5.76096 sequence = TTTCAAACAAGTGTTTGTCA Gene: PA3006: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family |
*
Pseudomonas entomophila L48 Site: position = -45 score = 4.74262 sequence = CCTGAAACGTATGTTTCAAA Site: position = -32 score = 5.71344 sequence = TTTCAAACAACTGTTTGTCA Gene: PSEEN3720: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family |
*
Pseudomonas putida KT2440 Site: position = -54 score = 4.95268 sequence = GCTGAAACGTATGTTTCAAA Site: position = -41 score = 5.67532 sequence = TTTCAAACACCTGTTTGTCT Gene: PP2144: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -31 score = 5.63936 sequence = TTTCAAACGTTCGTTTGTTA Gene: PSPTO3508: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family |
*
Pseudomonas fluorescens Pf-5 Site: position = -45 score = 4.74262 sequence = CCTGAAACGTATGTTTCAAA Site: position = -32 score = 5.76096 sequence = TTTCAAACAAGTGTTTGTCA Gene: PFL_1950: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family |
*
Pseudomonas mendocina ymp Site: position = -44 score = 4.95268 sequence = GCTGAAACGTATGTTTCAAA Site: position = -31 score = 5.76096 sequence = TTTCAAACAAGTGTTTGTCA Gene: Pmen_1588: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family |
*
Pseudomonas stutzeri A1501 Site: position = -32 score = 5.63491 sequence = TTTCAAACAGTTGTTTGTCT Gene: PST_1735: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family |
Gene: Avin_14520: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family |
Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family |
| CRON 10. | |||||||||
| etfB |
*
Pseudomonas aeruginosa PAO1 Site: position = -218 score = 5.57571 sequence = ATACAAACGTTTGTTTGAAT Gene: PA2952: Electron transfer flavoprotein, beta subunit |
*
Pseudomonas entomophila L48 Site: position = -391 score = 5.57571 sequence = ATACAAACGTTTGTTTGAAT Gene: PSEEN3658: Electron transfer flavoprotein, beta subunit |
*
Pseudomonas putida KT2440 Site: position = -392 score = 5.57571 sequence = ATACAAACGTTTGTTTGAAT Gene: PP4202: Electron transfer flavoprotein, beta subunit |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -373 score = 5.57571 sequence = ATACAAACGTTTGTTTGAAT Gene: PSPTO2185: Electron transfer flavoprotein, beta subunit |
*
Pseudomonas fluorescens Pf-5 Site: position = -393 score = 5.57571 sequence = ATACAAACGTTTGTTTGAAT Gene: PFL_1819: Electron transfer flavoprotein, beta subunit |
*
Pseudomonas mendocina ymp Site: position = -221 score = 5.57571 sequence = ATACAAACGTTTGTTTGAAT Gene: Pmen_2707: Electron transfer flavoprotein, beta subunit |
*
Pseudomonas stutzeri A1501 Site: position = -323 score = 5.57571 sequence = ATACAAACGTTTGTTTGAAT Gene: PST_2605: Electron transfer flavoprotein, beta subunit |
2
Azotobacter vinelandii AvOP Gene: Avin_15180: Electron transfer flavoprotein, beta subunit Gene: Avin_14280: Electron transfer flavoprotein, beta subunit |
Electron transfer flavoprotein, beta subunit |
| etfA |
Gene: PA2951: Electron transfer flavoprotein, alpha subunit |
Gene: PSEEN3657: Electron transfer flavoprotein, alpha subunit |
Gene: PP4201: Electron transfer flavoprotein, alpha subunit |
Gene: PSPTO2186: Electron transfer flavoprotein, alpha subunit |
Gene: PFL_1820: Electron transfer flavoprotein, alpha subunit |
Gene: Pmen_2706: Electron transfer flavoprotein, alpha subunit |
Gene: PST_2604: Electron transfer flavoprotein, alpha subunit |
2
Azotobacter vinelandii AvOP Gene: Avin_15190: Electron transfer flavoprotein, alpha subunit Gene: Avin_14290: Electron transfer flavoprotein, alpha subunit |
Electron transfer flavoprotein, alpha subunit |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |