Regulon of PsrA in Pseudomonas fluorescens Pf-5

Properties
Regulator type:	Transcription factor
TF locus tag:	PFL_1950
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Fatty acid degradation
Effector:	Oleate
Regulog:	PsrA - Pseudomonadaceae
Statistics of regulated genes:
- Genes	12
- Operons	9
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 69 sites [see more]

Member of regulog collections

By trascription factor - PsrA
By taxonomy - Pseudomonadaceae
By TF family - TetR
By effector - Oleate
By pathway - Fatty acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -76 Score: 4.5 Sequence: TTTTAAACGGCTGTTTTAGC Locus tag: PFL_1826 Name: null Funciton: Proteinase inhibitor
	PFL_1826		Proteinase inhibitor
Position: -180 Score: 5.7 Sequence: AATCAAACGGGCGTATGAAA Locus tag: PFL_1940 Name: fadB Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: PFL_1941 Name: fadA Funciton: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
	PFL_1940	fadB	Enoyl-CoA hydratase (EC 4.2.1.17)
	PFL_1941	fadA	3-ketoacyl-CoA thiolase (EC 2.3.1.16)
Position: -78 Score: 5.7 Sequence: TTTCAAACAACTGTTTGACC Locus tag: PFL_5687 Name: acdH1 Funciton: probable acyl-CoA dehydrogenase
	PFL_5687	acdH1	probable acyl-CoA dehydrogenase
Position: -393 Score: 5.6 Sequence: ATACAAACGTTTGTTTGAAT Locus tag: PFL_1819 Name: etfB Funciton: Electron transfer flavoprotein, beta subunit Locus tag: PFL_1820 Name: etfA Funciton: Electron transfer flavoprotein, alpha subunit
	PFL_1819	etfB	Electron transfer flavoprotein, beta subunit
	PFL_1820	etfA	Electron transfer flavoprotein, alpha subunit
Position: -176 Score: 5.9 Sequence: ATTCAAACAAACGTTTGTAT Locus tag: PFL_1818 Name: etfD Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
	PFL_1818	etfD	Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
Position: -88 Score: 5.7 Sequence: TTTCAAACAAGCGTATGTTT Locus tag: PFL_3668 Name: null Funciton: Phosphoglycerate mutase family protein Locus tag: PFL_3669 Name: scp Funciton: Sterol-binding domain protein
	PFL_3668		Phosphoglycerate mutase family protein
	PFL_3669	scp	Sterol-binding domain protein
Position: -183 Score: 5.1 Sequence: GATTAAACGCTTGTATGAAC Locus tag: PFL_5997 Name: algQ Funciton: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ
	PFL_5997	algQ	Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ
Position: -429 Score: 5.1 Sequence: CTTCAAACGGTAGTTTGAAT Locus tag: PFL_1207 Name: rpoS Funciton: RNA polymerase sigma factor RpoS
	PFL_1207	rpoS	RNA polymerase sigma factor RpoS
Position: -45 Score: 4.7 Sequence: CCTGAAACGTATGTTTCAAA Position: -32 Score: 5.8 Sequence: TTTCAAACAAGTGTTTGTCA Locus tag: PFL_1950 Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
	PFL_1950	psrA	Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of PsrA in Pseudomonas fluorescens Pf-5

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --