Regulon of PsrA in Azotobacter vinelandii AvOP

Properties
Regulator type:	Transcription factor
TF locus tag:	Avin_14520
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Fatty acid degradation
Effector:	Oleate
Regulog:	PsrA - Pseudomonadaceae
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 69 sites [see more]

Member of regulog collections

By trascription factor - PsrA
By taxonomy - Pseudomonadaceae
By TF family - TetR
By effector - Oleate
By pathway - Fatty acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -422 Score: 4.8 Sequence: CCTCAAACGGCAGTTTGAAT Locus tag: Avin_38680 Name: rpoS Funciton: RNA polymerase sigma factor RpoS
	Avin_38680	rpoS	RNA polymerase sigma factor RpoS

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD