Regulon of PsrA in Pseudomonas entomophila L48

Properties
Regulator type:	Transcription factor
TF locus tag:	PSEEN3720
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Fatty acid degradation
Effector:	Oleate
Regulog:	PsrA - Pseudomonadaceae
Statistics of regulated genes:
- Genes	13
- Operons	10
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 69 sites [see more]

Member of regulog collections

By trascription factor - PsrA
By taxonomy - Pseudomonadaceae
By TF family - TetR
By effector - Oleate
By pathway - Fatty acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -102 Score: 4.9 Sequence: GTTCAAACGCCTGTTTAATG Locus tag: PSEEN1703 Name: fadH Funciton: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
	PSEEN1703	fadH	2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
Position: -72 Score: 5.4 Sequence: TTTCAAACGTATGTTTGAGC Locus tag: PSEEN3648 Name: null Funciton: Proteinase inhibitor
	PSEEN3648		Proteinase inhibitor
Position: -87 Score: 5.7 Sequence: TTTCAAACAACTGTTTGACC Locus tag: PSEEN5115 Name: acdH1 Funciton: probable acyl-CoA dehydrogenase
	PSEEN5115	acdH1	probable acyl-CoA dehydrogenase
Position: -153 Score: 5.9 Sequence: ATTCAAACAAACGTTTGTAT Locus tag: PSEEN3660 Name: etfD Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
	PSEEN3660	etfD	Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
Position: -99 Score: 5.2 Sequence: GTTCAAACGACCTTTTCAAA Position: -86 Score: 5.7 Sequence: TTTCAAACGCTTGTATGTTT Locus tag: PSEEN2270 Name: null Funciton: Phosphoglycerate mutase family protein Locus tag: PSEEN2269 Name: scp Funciton: Sterol-binding domain protein
	PSEEN2270		Phosphoglycerate mutase family protein
	PSEEN2269	scp	Sterol-binding domain protein
Position: -182 Score: 5.1 Sequence: GATTAAACGCTTGTATGAAC Locus tag: PSEEN0159 Name: algQ Funciton: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ
	PSEEN0159	algQ	Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ
Position: -391 Score: 5.6 Sequence: ATACAAACGTTTGTTTGAAT Locus tag: PSEEN3658 Name: etfB Funciton: Electron transfer flavoprotein, beta subunit Locus tag: PSEEN3657 Name: etfA Funciton: Electron transfer flavoprotein, alpha subunit
	PSEEN3658	etfB	Electron transfer flavoprotein, beta subunit
	PSEEN3657	etfA	Electron transfer flavoprotein, alpha subunit
Position: -162 Score: 5.7 Sequence: AATCAAACGGGCGTATGAAT Locus tag: PSEEN3728 Name: fadB Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: PSEEN3727 Name: fadA Funciton: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
	PSEEN3728	fadB	Enoyl-CoA hydratase (EC 4.2.1.17)
	PSEEN3727	fadA	3-ketoacyl-CoA thiolase (EC 2.3.1.16)
Position: -45 Score: 4.7 Sequence: CCTGAAACGTATGTTTCAAA Position: -32 Score: 5.7 Sequence: TTTCAAACAACTGTTTGTCA Locus tag: PSEEN3720 Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
	PSEEN3720	psrA	Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Position: -428 Score: 5.1 Sequence: CTTCAAACGGTAGTTTGAAT Locus tag: PSEEN4189 Name: rpoS Funciton: RNA polymerase sigma factor RpoS
	PSEEN4189	rpoS	RNA polymerase sigma factor RpoS

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of PsrA in Pseudomonas entomophila L48

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --