Regulon of PsrA in Pseudomonas stutzeri A1501

Properties
Regulator type:	Transcription factor
TF locus tag:	PST_1735
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Fatty acid degradation
Effector:	Oleate
Regulog:	PsrA - Pseudomonadaceae
Statistics of regulated genes:
- Genes	10
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 69 sites [see more]

Member of regulog collections

By trascription factor - PsrA
By taxonomy - Pseudomonadaceae
By TF family - TetR
By effector - Oleate
By pathway - Fatty acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -323 Score: 5.6 Sequence: ATACAAACGTTTGTTTGAAT Locus tag: PST_2605 Name: etfB Funciton: Electron transfer flavoprotein, beta subunit Locus tag: PST_2604 Name: etfA Funciton: Electron transfer flavoprotein, alpha subunit
	PST_2605	etfB	Electron transfer flavoprotein, beta subunit
	PST_2604	etfA	Electron transfer flavoprotein, alpha subunit
Position: -421 Score: 4.8 Sequence: CCTCAAACGGTAGTTTGAAT Locus tag: PST_1572 Name: rpoS Funciton: RNA polymerase sigma factor RpoS
	PST_1572	rpoS	RNA polymerase sigma factor RpoS
Position: -130 Score: 5.9 Sequence: ATTCAAACAAACGTTTGTAT Locus tag: PST_2607 Name: etfD Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
	PST_2607	etfD	Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
Position: -146 Score: 5.6 Sequence: ATTCAAACAAACGTTCGAAT Locus tag: PST_2241 Name: null Funciton: Phosphoglycerate mutase family protein Locus tag: PST_2242 Name: scp Funciton: Sterol-binding domain protein
	PST_2241		Phosphoglycerate mutase family protein
	PST_2242	scp	Sterol-binding domain protein
Position: -32 Score: 5.6 Sequence: TTTCAAACAGTTGTTTGTCT Locus tag: PST_1735 Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
	PST_1735	psrA	Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Position: -71 Score: 4.7 Sequence: GTCGAAACGTATGTTTCAAA Position: -58 Score: 5.7 Sequence: TTTCAAACGCCTGTTTGACC Locus tag: PST_3860 Name: acdH1 Funciton: probable acyl-CoA dehydrogenase
	PST_3860	acdH1	probable acyl-CoA dehydrogenase
Position: -155 Score: 5.7 Sequence: AATCAAACGGGCGTATGAAT Locus tag: PST_1726 Name: fadB Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: PST_1727 Name: fadA Funciton: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
	PST_1726	fadB	Enoyl-CoA hydratase (EC 4.2.1.17)
	PST_1727	fadA	3-ketoacyl-CoA thiolase (EC 2.3.1.16)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD