Regulog Fur - Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Alteromonadales
- By trascription factor - FUR
- By TF family - FUR
- By effector - Iron ion, (Fe2+)
- By pathway - Iron homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Pseudoalteromonas atlantica T6c | 31 | 17 |
| Alteromonas macleodii 'Deep ecotype' | 14 | 10 |
| Glaciecola sp. HTCC2999 | 6 | 4 |
| Colwellia psychrerythraea 34H | 18 | 10 |
| Alteromonadales bacterium TW-7 | 29 | 16 |
| Pseudoalteromonas haloplanktis TAC125 | 23 | 15 |
| Pseudoalteromonas tunicata D2 | 40 | 20 |
| Idiomarina baltica OS145 | 21 | 10 |
| Idiomarina loihiensis L2TR | 29 | 18 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| MADE_01602 |
|
*
Alteromonas macleodii 'Deep ecotype' Site: position = -8 score = 5.98354 sequence = AAATGCTAATGGTTATCATTT Gene: MADE_01602: hypothetical protein |
|
|
|
|
|
|
|
hypothetical protein |
| fumC |
Gene: Patl_2056: Fumarate hydratase class II (EC 4.2.1.2) |
Gene: MADE_01603: Fumarate hydratase class II (EC 4.2.1.2) |
|
|
Gene: ATW7_16525: Fumarate hydratase class II (EC 4.2.1.2) |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -147 score = 5.61009 sequence = TAATGATAACTATTATCAAAT Gene: PSHAa0048: Fumarate hydratase class II (EC 4.2.1.2) |
|
Gene: OS145_12574: Fumarate hydratase class II (EC 4.2.1.2) |
Gene: IL0937: Fumarate hydratase class II (EC 4.2.1.2) |
Fumarate hydratase class II (EC 4.2.1.2) |
| ATW7_16530 |
|
|
|
|
*
Alteromonadales bacterium TW-7 Site: position = -116 score = 6.0493 sequence = TAATGATAACTATTATCATTA Gene: ATW7_16530: hypothetical protein |
|
|
|
|
hypothetical protein |
| CRON 2. | ||||||||||
| PF11449 |
|
|
|
Gene: CPS_2709: Predicted manganese transporter, 11 TMS |
*
Alteromonadales bacterium TW-7 Site: position = -68 score = 6.16607 sequence = AAATGATATTGATTATCATTT Gene: ATW7_13233: Predicted manganese transporter, 11 TMS |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -67 score = 6.16607 sequence = AAATGATATTGATTATCATTT Gene: PSHAa1629: Predicted manganese transporter, 11 TMS |
*
Pseudoalteromonas tunicata D2 Site: position = -66 score = 6.16607 sequence = AAATGATATTGATTATCATTT Gene: PTD2_19380: Predicted manganese transporter, 11 TMS |
|
|
Predicted manganese transporter, 11 TMS |
| CRON 3. | ||||||||||
| COG4771 |
*
Pseudoalteromonas atlantica T6c Site: position = -66 score = 5.59969 sequence = AAATGATAACGATTACTATTT Gene: Patl_1486: Outer membrane receptor for ferrienterochelin, TonB-dependent |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -33 score = 4.77727 sequence = AAATCATTATCATTTGCATTA Site: position = -39 score = 5.56568 sequence = AAACGCAAATCATTATCATTT Gene: MADE_01534: Outer membrane receptor for ferrienterochelin, TonB-dependent |
|
|
|
|
|
|
|
Outer membrane receptor for ferrienterochelin, TonB-dependent |
| Patl_1487 |
Gene: Patl_1487: hypothetical protein |
Gene: MADE_01535: hypothetical protein |
|
|
|
|
|
|
|
hypothetical protein |
| hmuT |
Gene: Patl_1488: Hemin ABC transporter, periplasmic component |
Gene: MADE_01536: Hemin ABC transporter, periplasmic component |
|
|
|
Gene: PSHAb0068: Hemin ABC transporter, periplasmic component |
*
Pseudoalteromonas tunicata D2 Site: position = -76 score = 5.94187 sequence = TAATGAGAAGTATTATCATTT Gene: PTD2_10203: Hemin ABC transporter, periplasmic component |
*
Idiomarina baltica OS145 Site: position = -81 score = 5.39068 sequence = AAACGAAAACTATTTGCATTT Gene: OS145_06449: Hemin ABC transporter, periplasmic component |
*
Idiomarina loihiensis L2TR Site: position = -87 score = 5.53221 sequence = AAACGAAAATGATTTGCATTT Gene: IL0113: Hemin ABC transporter, periplasmic component |
Hemin ABC transporter, periplasmic component |
| hmuU |
Gene: Patl_1489: Hemin ABC transporter, permease protein |
Gene: MADE_01537: Hemin ABC transporter, permease protein |
|
|
|
Gene: PSHAb0067: Hemin ABC transporter, permease protein |
Gene: PTD2_10198: Hemin ABC transporter, permease protein |
Gene: OS145_06454: Hemin ABC transporter, permease protein |
Gene: IL0114: Hemin ABC transporter, permease protein |
Hemin ABC transporter, permease protein |
| hmuV |
Gene: Patl_1490: Hemin ABC transporter, ATP-binding protein |
Gene: MADE_01538: Hemin ABC transporter, ATP-binding protein |
|
|
|
Gene: PSHAb0066: Hemin ABC transporter, ATP-binding protein |
Gene: PTD2_10193: Hemin ABC transporter, ATP-binding protein |
Gene: OS145_06459: Hemin ABC transporter, ATP-binding protein |
Gene: IL0115: Hemin ABC transporter, ATP-binding protein |
Hemin ABC transporter, ATP-binding protein |
| COG0748 |
Gene: Patl_1491: Putative heme iron utilization protein |
Gene: MADE_01539: Putative heme iron utilization protein |
|
|
|
|
|
Gene: OS145_06464: Putative heme iron utilization protein |
Gene: IL0116: Putative heme iron utilization protein |
Putative heme iron utilization protein |
| CRON 4. | ||||||||||
| Patl_2402 |
*
Pseudoalteromonas atlantica T6c Site: position = -27 score = 5.99733 sequence = AAATGATAATAATTAGCATTA Gene: Patl_2402: Ferric aerobactin receptor |
|
|
*
Colwellia psychrerythraea 34H Site: position = -66 score = 5.90853 sequence = AAATAATAACAATTATCATTA Gene: CPS_4213: Ferric aerobactin receptor |
|
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -49 score = 5.1953 sequence = TATTGTTAATAGTTATCATTA Gene: PSHAb0286: Ferric aerobactin receptor |
*
Pseudoalteromonas tunicata D2 Site: position = -23 score = 5.87506 sequence = AAATAAAAACAATTATCATTA Gene: PTD2_01521: Ferric aerobactin receptor |
*
Idiomarina baltica OS145 Site: position = -52 score = 5.95517 sequence = TAATGAGAACAATTATCATCT Site: position = -17 score = 5.46783 sequence = AAATGATAAGGATTCTCATGT Gene: OS145_03090: Ferric aerobactin receptor |
|
Ferric aerobactin receptor |
| pepSY |
Gene: Patl_2403: Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB |
|
|
|
|
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -149 score = 5.14722 sequence = AATTGAAAACTGCTCTCATTA Gene: PSHAb0287: Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB |
|
Gene: OS145_03095: Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB |
|
Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB |
| CRON 5. | ||||||||||
| COG4774 |
*
Pseudoalteromonas atlantica T6c Site: position = -59 score = 5.32186 sequence = AAATGATATTAATTACCATTC Gene: Patl_3803: Outer membrane receptor for monomeric catechols, TonB-dependent |
|
|
*
Colwellia psychrerythraea 34H Site: position = -62 score = 5.97483 sequence = TATTGATAATCATTATCATTA Site: position = -296 score = 4.7436 sequence = AAATGAAAAATATTATAAAAA Gene: CPS_1347: Outer membrane receptor for monomeric catechols, TonB-dependent |
*
Alteromonadales bacterium TW-7 Site: position = -20 score = 5.43922 sequence = AAATGCGAATGGTTATCATAA Site: position = -59 score = 4.55243 sequence = TTTTGCAAATAATAATCATTA Site: position = -53 score = 5.59969 sequence = AAATAATAATCATTACCATTA Gene: ATW7_00380: Outer membrane receptor for monomeric catechols, TonB-dependent |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -22 score = 4.83279 sequence = AAATACGAATACTTACCATTA Site: position = -55 score = 5.24349 sequence = TAACGATAACCATTATCATTC Gene: PSHAb0512: Outer membrane receptor for monomeric catechols, TonB-dependent |
*
Pseudoalteromonas tunicata D2 Site: position = -47 score = 5.61508 sequence = AACTGATAATTATTATCATTC Site: position = -92 score = 5.01616 sequence = AAATAATAATTATTCGTATAA Gene: PTD2_20667: Outer membrane receptor for monomeric catechols, TonB-dependent |
|
|
Outer membrane receptor for monomeric catechols, TonB-dependent |
| ATW7_00890 |
Gene: Patl_3802: iron uptake protein |
|
|
*
Colwellia psychrerythraea 34H Site: position = -148 score = 6.01659 sequence = AAATGATAATGGTTTTTATTT Gene: CPS_0262: iron uptake protein |
*
Alteromonadales bacterium TW-7 Site: position = -87 score = 5.191 sequence = AAATGAGAATCACTATCTTTT Gene: ATW7_00890: iron uptake protein |
Gene: PSHAb0042: iron uptake protein |
*
Pseudoalteromonas tunicata D2 Site: position = -83 score = 5.2048 sequence = AAATGAGAATTACTATCTTTT Gene: PTD2_01631: iron uptake protein |
|
|
iron uptake protein |
| pepSY |
Gene: Patl_3801: iron-regulated membrane protein |
|
|
Gene: CPS_0263: iron-regulated membrane protein |
Gene: ATW7_00895: iron-regulated membrane protein |
Gene: PSHAb0043: iron-regulated membrane protein |
Gene: PTD2_01626: iron-regulated membrane protein |
|
|
iron-regulated membrane protein |
| ATW7_00900 |
|
|
|
Gene: CPS_0264: iron uptake protein |
Gene: ATW7_00900: iron uptake protein |
|
Gene: PTD2_01621: iron uptake protein |
|
|
iron uptake protein |
| CRON 6. | ||||||||||
| CPS_0694 |
|
|
|
Gene: CPS_0694: Iron-regulated protein A precursor |
|
|
*
Pseudoalteromonas tunicata D2 Site: position = -29 score = 5.87332 sequence = AAATAAGATTTATTATCATTT Site: position = -85 score = 6.02454 sequence = AAATGATATTTATTATCATTA Gene: PTD2_09069: Iron-regulated protein A precursor |
|
|
Iron-regulated protein A precursor |
| CPS_0695 |
|
|
|
Gene: CPS_0695: Probable thiol oxidoreductase with 2 cytochrome c heme-binding sites |
|
|
Gene: PTD2_09074: Probable thiol oxidoreductase with 2 cytochrome c heme-binding sites |
|
|
Probable thiol oxidoreductase with 2 cytochrome c heme-binding sites |
| PTD2_09079 |
|
|
|
|
|
|
Gene: PTD2_09079: Probable thiol oxidoreductase with 2 cytochrome c heme-binding sites |
|
|
Probable thiol oxidoreductase with 2 cytochrome c heme-binding sites |
| irpA |
|
|
|
|
|
|
2
Pseudoalteromonas tunicata D2 Gene: PTD2_15702: Iron-regulated protein A precursor Gene: PTD2_09084: Iron-regulated protein A precursor |
|
|
Iron-regulated protein A precursor |
| PTD2_15697 |
|
|
|
|
|
|
*
Pseudoalteromonas tunicata D2 Site: position = -82 score = 5.52319 sequence = TAATGAGATTGATTATCATTG Site: position = -158 score = 4.82328 sequence = AAATAAAAATAATACTTATCA Site: position = -155 score = 4.61983 sequence = TAAAAATAATACTTATCATAT Gene: PTD2_15697: VCBS |
|
|
VCBS |
| fecA |
*
Pseudoalteromonas atlantica T6c Site: position = -105 score = 5.43722 sequence = TATTGATAATAGTTTGCATTA Gene: Patl_3109: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins |
Gene: MADE_02035: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins |
*
Glaciecola sp. HTCC2999 Site: position = -85 score = 5.92917 sequence = AATTGAGATTGATTCTCATTT Gene: GHTCC_010100005799: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins |
|
*
Alteromonadales bacterium TW-7 Site: position = -74 score = 4.93397 sequence = TAATAATATTGATTCGCATTC Gene: ATW7_03447: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -78 score = 4.74573 sequence = GAATAACATTGATTCTCATTC Gene: PSHAa2478: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins |
Gene: PTD2_15707: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins |
*
Idiomarina baltica OS145 Site: position = -64 score = 5.25706 sequence = AATTGCGAATTATTCGTATTT Gene: OS145_08648: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins |
*
Idiomarina loihiensis L2TR Site: position = -88 score = 5.45055 sequence = TATTGCGAATCATTCTTATTT Gene: IL2393: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins |
TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins |
| CRON 7. | ||||||||||
| bfd |
*
Pseudoalteromonas atlantica T6c Site: position = -46 score = 5.38093 sequence = AAACAACAATTATTATCATTT Gene: Patl_1397: Bacterioferritin-associated ferredoxin |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -57 score = 5.06263 sequence = GAATAGCAATTATTATCATTT Gene: MADE_02744: Bacterioferritin-associated ferredoxin |
*
Glaciecola sp. HTCC2999 Site: position = -46 score = 5.89808 sequence = AAATGAGAACTATTATTATTA Gene: GHTCC_010100007522: Bacterioferritin-associated ferredoxin |
*2
Colwellia psychrerythraea 34H Site: position = -76 score = 5.8333 sequence = TATTGATAATTGTTATCATTA Gene: CPS_1169: Bacterioferritin-associated ferredoxin Gene: CPS_1311: Bacterioferritin-associated ferredoxin |
|
|
|
*
Idiomarina baltica OS145 Site: position = -136 score = 5.17397 sequence = TGTTGAAAATCGTTCGCATTA Gene: OS145_11871: Bacterioferritin-associated ferredoxin |
*
Idiomarina loihiensis L2TR Site: position = -57 score = 5.20568 sequence = TATTGCAAATCGTTCGCATTT Gene: IL1065: Bacterioferritin-associated ferredoxin |
Bacterioferritin-associated ferredoxin |
| bfr2 |
*
Pseudoalteromonas atlantica T6c Site: position = -147 score = 4.51648 sequence = AATCATCAATTATTCTCATTT Gene: Patl_2076: Bacterioferritin, subunit 2 |
|
Gene: GHTCC_010100006129: Bacterioferritin, subunit 2 |
Gene: CPS_1168: Bacterioferritin, subunit 2 |
Gene: ATW7_02492: Bacterioferritin, subunit 2 |
Gene: PSHAb0283: Bacterioferritin, subunit 2 |
*
Pseudoalteromonas tunicata D2 Site: position = -157 score = 4.91838 sequence = AAATAACAATAATTGTTATTC Gene: PTD2_02826: Bacterioferritin, subunit 2 |
Gene: OS145_11876: Bacterioferritin, subunit 2 |
Gene: IL1066: Bacterioferritin, subunit 2 |
Bacterioferritin, subunit 2 |
| bfr1 |
Gene: Patl_2075: Bacterioferritin subunit 1 |
Gene: MADE_02052: Bacterioferritin subunit 1 |
Gene: GHTCC_010100006124: Bacterioferritin subunit 1 |
*
Colwellia psychrerythraea 34H Site: position = -155 score = 4.62579 sequence = TAATGAAAATACAAATTATTT Site: position = -149 score = 5.36654 sequence = AAATACAAATTATTTTCACTT Gene: CPS_1167: Bacterioferritin subunit 1 |
Gene: ATW7_02497: Bacterioferritin subunit 1 |
Gene: PSHAb0284: Bacterioferritin subunit 1 |
Gene: PTD2_02821: Bacterioferritin subunit 1 |
Gene: OS145_11881: Bacterioferritin subunit 1 |
Gene: IL1067: Bacterioferritin subunit 1 |
Bacterioferritin subunit 1 |
| CRON 8. | ||||||||||
| CPS_1855 |
|
|
|
*
Colwellia psychrerythraea 34H Site: position = -155 score = 5.06485 sequence = AAATGTAAATTGTTATCAATC Gene: CPS_1855: conserved protein of unknown function; putative membrane-associated protein |
*
Alteromonadales bacterium TW-7 Site: position = -48 score = 5.33449 sequence = TAATGCAAATCATTATCATGT Gene: ATW7_15879: conserved protein of unknown function; putative membrane-associated protein |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -49 score = 5.03841 sequence = TAATACAAATCATTATCATGT Gene: PSHAa2970: conserved protein of unknown function; putative membrane-associated protein |
*
Pseudoalteromonas tunicata D2 Site: position = -162 score = 5.83407 sequence = AAATAATAACCATTATCAATT Gene: PTD2_16666: conserved protein of unknown function; putative membrane-associated protein |
Gene: OS145_04638: conserved protein of unknown function; putative membrane-associated protein |
*
Idiomarina loihiensis L2TR Site: position = -89 score = 5.87239 sequence = AAATGAGAATTTTTATCATTA Site: position = -60 score = 5.47227 sequence = AAATGAGAACGGTTTTTATAT Gene: IL2502: conserved protein of unknown function; putative membrane-associated protein |
conserved protein of unknown function; putative membrane-associated protein |
| CPS_1856 |
|
|
|
Gene: CPS_1856: putative exported protein |
Gene: ATW7_15884: putative exported protein |
Gene: PSHAa2971: putative exported protein |
Gene: PTD2_16671: putative exported protein |
|
|
putative exported protein |
| ATW7_15889 |
|
|
|
|
Gene: ATW7_15889: Uncharacterized metal-binding protein |
Gene: PSHAa2972: Uncharacterized metal-binding protein |
Gene: PTD2_16676: Uncharacterized metal-binding protein |
Gene: OS145_04643: Uncharacterized metal-binding protein |
Gene: IL2503: Uncharacterized metal-binding protein |
Uncharacterized metal-binding protein |
| irgA |
|
|
|
|
|
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -47 score = 5.92287 sequence = AAATGCTAATCATTATCAATT Gene: PSHAb0251: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins |
|
*
Idiomarina baltica OS145 Site: position = -39 score = 6.01994 sequence = AAATAAAAACTATTCTCATTT Gene: OS145_04633: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins |
*
Idiomarina loihiensis L2TR Site: position = -42 score = 5.95341 sequence = TAATGAAAATAATTCGCATTT Gene: IL2490: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins |
TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins |
| CRON 9. | ||||||||||
| fhuE |
*
Pseudoalteromonas atlantica T6c Site: position = -97 score = 5.17769 sequence = GAATGCAAATAGTTATCATAT Gene: Patl_0311: TonB-dependent siderophore receptor |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -102 score = 5.47026 sequence = AAATAGCAATAATTATCATTT Gene: MADE_00133: TonB-dependent siderophore receptor |
|
*
Colwellia psychrerythraea 34H Site: position = -85 score = 5.14774 sequence = TAACGATAATGATTAGTATTT Site: position = -79 score = 4.89467 sequence = TAATGATTAGTATTTGCATTT Gene: CPS_2724: TonB-dependent siderophore receptor |
|
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -65 score = 5.55399 sequence = AATTGCAAATCAATATCATTT Gene: PSHAa0695: TonB-dependent siderophore receptor |
*
Pseudoalteromonas tunicata D2 Site: position = -66 score = 6.29928 sequence = AATTGATAATAATTATCATTT Gene: PTD2_04291: TonB-dependent siderophore receptor |
*
Idiomarina baltica OS145 Site: position = -190 score = 5.02585 sequence = AAATAAGAATGATTATGTTTT Site: position = -184 score = 4.92171 sequence = GAATGATTATGTTTTTCATTT Site: position = -162 score = 5.73994 sequence = AGTTGATAATCATTCTTATTT Site: position = -63 score = 5.3999 sequence = AAACGCGAATCGTTTTCATTT Gene: OS145_01627: TonB-dependent siderophore receptor |
|
TonB-dependent siderophore receptor |
| pepSY |
|
|
|
Gene: CPS_2723: putative iron-regulated membrane protein |
*
Alteromonadales bacterium TW-7 Site: position = -51 score = 5.42991 sequence = AAATAACAATTGATATCATTT Gene: ATW7_15829: putative iron-regulated membrane protein |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -52 score = 5.12076 sequence = AATTGATAATTGTTATCATGC Gene: PSHAa2961: putative iron-regulated membrane protein |
Gene: PTD2_04296: putative iron-regulated membrane protein |
|
|
putative iron-regulated membrane protein |
| CRON 10. | ||||||||||
| MADE_00161 |
|
*
Alteromonas macleodii 'Deep ecotype' Site: position = 5 score = 5.71778 sequence = TAATGATAATAAGTATCATTT Gene: MADE_00161: putative orphan protein |
|
|
*
Alteromonadales bacterium TW-7 Site: position = -48 score = 5.00366 sequence = ATATGATAATGTCTATCATTT Gene: ATW7_13138: putative orphan protein |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -45 score = 5.08694 sequence = ATATGATAATACCTATCATTT Gene: PSHAa1611: putative orphan protein |
|
|
|
putative orphan protein |
| fbpA |
*
Pseudoalteromonas atlantica T6c Site: position = -32 score = 6.07283 sequence = AATTGATAATTATTCTCAATT Gene: Patl_1596: Ferric iron ABC transporter, iron-binding protein |
Gene: MADE_00162: Ferric iron ABC transporter, iron-binding protein |
*
Glaciecola sp. HTCC2999 Site: position = -61 score = 5.75173 sequence = TATTGAGAATTATTCTCAATA Gene: GHTCC_010100005814: Ferric iron ABC transporter, iron-binding protein |
*
Colwellia psychrerythraea 34H Site: position = -86 score = 4.64584 sequence = TAATGAGAGTGATTCGTATAT Gene: CPS_1012: Ferric iron ABC transporter, iron-binding protein |
*2
Alteromonadales bacterium TW-7 Site: position = -31 score = 5.39749 sequence = TATTGATAATAATTACTATTT Gene: ATW7_12358: Ferric iron ABC transporter, iron-binding protein Gene: ATW7_13143: Ferric iron ABC transporter, iron-binding protein |
*2
Pseudoalteromonas haloplanktis TAC125 Site: position = -32 score = 5.28491 sequence = TATTGATAATAGTTATTATTC Gene: PSHAa2663: Ferric iron ABC transporter, iron-binding protein Gene: PSHAa1612: Ferric iron ABC transporter, iron-binding protein |
*
Pseudoalteromonas tunicata D2 Site: position = -33 score = 5.6142 sequence = ATTTGATAATAATTCTTATTT Gene: PTD2_08484: Ferric iron ABC transporter, iron-binding protein |
*
Idiomarina baltica OS145 Site: position = -83 score = 5.53821 sequence = AAATGAGAATGGCTATCATTA Gene: OS145_11901: Ferric iron ABC transporter, iron-binding protein |
*
Idiomarina loihiensis L2TR Site: position = -84 score = 5.53821 sequence = AAATGAGAATGGCTATCATTA Gene: IL1059: Ferric iron ABC transporter, iron-binding protein |
Ferric iron ABC transporter, iron-binding protein |
| fbpB |
Gene: Patl_1597: Ferric iron ABC transporter, permease protein |
Gene: MADE_00163: Ferric iron ABC transporter, permease protein |
Gene: GHTCC_010100005809: Ferric iron ABC transporter, permease protein |
Gene: CPS_1013: Ferric iron ABC transporter, permease protein |
2
Alteromonadales bacterium TW-7 Gene: ATW7_12353: Ferric iron ABC transporter, permease protein Gene: ATW7_13148: Ferric iron ABC transporter, permease protein |
2
Pseudoalteromonas haloplanktis TAC125 Gene: PSHAa2662: Ferric iron ABC transporter, permease protein Gene: PSHAa1613: Ferric iron ABC transporter, permease protein |
Gene: PTD2_08489: Ferric iron ABC transporter, permease protein |
Gene: OS145_11896: Ferric iron ABC transporter, permease protein |
Gene: IL1060: Ferric iron ABC transporter, permease protein |
Ferric iron ABC transporter, permease protein |
| fbpC |
Gene: Patl_1598: Ferric iron ABC transporter, ATP-binding protein |
Gene: MADE_00164: Ferric iron ABC transporter, ATP-binding protein |
Gene: GHTCC_010100005804: Ferric iron ABC transporter, ATP-binding protein |
Gene: CPS_1014: Ferric iron ABC transporter, ATP-binding protein |
2
Alteromonadales bacterium TW-7 Gene: ATW7_12348: Ferric iron ABC transporter, ATP-binding protein Gene: ATW7_13153: Ferric iron ABC transporter, ATP-binding protein |
2
Pseudoalteromonas haloplanktis TAC125 Gene: PSHAa2661: Ferric iron ABC transporter, ATP-binding protein Gene: PSHAa1614: Ferric iron ABC transporter, ATP-binding protein |
Gene: PTD2_08494: Ferric iron ABC transporter, ATP-binding protein |
Gene: OS145_11891: Ferric iron ABC transporter, ATP-binding protein |
Gene: IL1061: Ferric iron ABC transporter, ATP-binding protein |
Ferric iron ABC transporter, ATP-binding protein |
| yfeK |
*
Pseudoalteromonas atlantica T6c Site: position = -260 score = 4.57443 sequence = TAATAATAACAATACTCACCT Gene: Patl_0493: Predicted iron-dependent peroxidase, Dyp-type family |
Gene: MADE_00482: Predicted iron-dependent peroxidase, Dyp-type family |
Gene: GHTCC_010100001919: Predicted iron-dependent peroxidase, Dyp-type family |
Gene: CPS_4479: Predicted iron-dependent peroxidase, Dyp-type family |
Gene: ATW7_12343: Predicted iron-dependent peroxidase, Dyp-type family |
Gene: PSHAa2660: Predicted iron-dependent peroxidase, Dyp-type family |
Gene: PTD2_08499: Predicted iron-dependent peroxidase, Dyp-type family |
Gene: OS145_05020: Predicted iron-dependent peroxidase, Dyp-type family |
Gene: IL0470: Predicted iron-dependent peroxidase, Dyp-type family |
Predicted iron-dependent peroxidase, Dyp-type family |
| CRON 11. | ||||||||||
| fpr |
*
Pseudoalteromonas atlantica T6c Site: position = -70 score = 4.98516 sequence = AAATAAGAATTATTACTATTG Gene: Patl_2287: Ferredoxin--NADP(+) reductase (EC 1.18.1.2) |
|
|
|
|
|
|
*
Idiomarina baltica OS145 Site: position = -103 score = 5.41781 sequence = ATATGCGATTTATTCTCATTT Site: position = -74 score = 5.99424 sequence = AAATGAAAAAAATTCTCATTT Gene: OS145_09243: Ferredoxin--NADP(+) reductase (EC 1.18.1.2) |
*
Idiomarina loihiensis L2TR Site: position = -104 score = 5.47227 sequence = ATATAAAAACCGTTCTCATTT Site: position = -75 score = 5.87239 sequence = TAATGATAAAAATTCTCATTT Gene: IL2501: Ferredoxin--NADP(+) reductase (EC 1.18.1.2) |
Ferredoxin--NADP(+) reductase (EC 1.18.1.2) |
| CRON 12. | ||||||||||
| CPS_3425 |
|
|
|
*
Colwellia psychrerythraea 34H Site: position = -104 score = 5.89577 sequence = AAATGATAATGATTACCATTA Gene: CPS_3425: Ferrichrome-iron receptor |
|
|
|
|
|
Ferrichrome-iron receptor |
| piuC |
|
|
|
Gene: CPS_3426: Iron-uptake factor PiuC |
|
|
|
*
Idiomarina baltica OS145 Site: position = -39 score = 5.39235 sequence = AAATGATAACTATTCGCAAAT Gene: OS145_07332: Iron-uptake factor PiuC |
*
Idiomarina loihiensis L2TR Site: position = -36 score = 5.15531 sequence = AAATGATAACTATTCGCAAGT Gene: IL0759: Iron-uptake factor PiuC |
Iron-uptake factor PiuC |
| CRON 13. | ||||||||||
| ahpCB |
*
Pseudoalteromonas atlantica T6c Site: position = -241 score = 5.38093 sequence = AAATGATAATAATTGTTGTTT Gene: Patl_1398: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-) |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -251 score = 5.06263 sequence = AAATGATAATAATTGCTATTC Gene: MADE_02743: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-) |
*
Glaciecola sp. HTCC2999 Site: position = -171 score = 5.89808 sequence = TAATAATAATAGTTCTCATTT Gene: GHTCC_010100007527: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-) |
Gene: CPS_3474: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-) |
Gene: ATW7_09746: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-) |
Gene: PSHAa0839: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-) |
Gene: PTD2_15612: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-) |
2
Idiomarina baltica OS145 Gene: OS145_09500: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-) Gene: OS145_10326: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-) |
2
Idiomarina loihiensis L2TR Gene: IL2576: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-) Gene: IL1803: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-) |
Alkyl hydroperoxide reductase protein C (EC 1.6.4.-) |
| CRON 14. | ||||||||||
| ftr1 |
*
Pseudoalteromonas atlantica T6c Site: position = -41 score = 6.20873 sequence = AAATAATAATTATTCTCATTT Gene: Patl_1058: High-affinity Fe2+/Pb2+ permease |
|
|
|
|
|
|
|
*
Idiomarina loihiensis L2TR Site: position = -85 score = 5.2256 sequence = AAACAACAATAGTTATCATTT Gene: IL0111: High-affinity Fe2+/Pb2+ permease |
High-affinity Fe2+/Pb2+ permease |
| CRON 15. | ||||||||||
| COG3205 |
*
Pseudoalteromonas atlantica T6c Site: position = -139 score = 5.34493 sequence = AAATGAGAATTAATCGTATTA Gene: Patl_0749: membrane protein |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -65 score = 6.1335 sequence = AATTGATAATAATTCTCATTA Gene: MADE_02392: membrane protein |
|
|
|
|
|
|
|
membrane protein |
| CRON 16. | ||||||||||
| Patl_1142 |
*
Pseudoalteromonas atlantica T6c Site: position = -72 score = 6.08624 sequence = AATTGAAAATCATTCTCATTA Gene: Patl_1142: TonB-dependent siderophore receptor |
|
|
|
*
Alteromonadales bacterium TW-7 Site: position = -54 score = 5.54866 sequence = TAATGATAGTCGTTATCATTT Gene: ATW7_09161: TonB-dependent siderophore receptor |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -56 score = 4.9233 sequence = AAATGAGAGTGGTTAGCATTC Gene: PSHAb0279: TonB-dependent siderophore receptor |
|
|
|
TonB-dependent siderophore receptor |
| Patl_1143 |
Gene: Patl_1143: putative iron-regulated membrane protein |
|
|
|
|
|
|
|
|
putative iron-regulated membrane protein |
| CRON 17. | ||||||||||
| bfd |
|
|
|
|
*
Alteromonadales bacterium TW-7 Site: position = -66 score = 5.24216 sequence = TATTGATAACTATTACTATTT Gene: ATW7_02487: Bacterioferritin-associated ferredoxin |
Gene: PSHAb0282: Bacterioferritin-associated ferredoxin |
*
Pseudoalteromonas tunicata D2 Site: position = -64 score = 5.79814 sequence = TATTGAAAATGATTGTCATTT Gene: PTD2_08349: Bacterioferritin-associated ferredoxin |
|
|
Bacterioferritin-associated ferredoxin |
| CRON 18. | ||||||||||
| Patl_0871 |
*2
Pseudoalteromonas atlantica T6c Site: position = -83 score = 5.75835 sequence = AAATAGTAATAATTCTCATTT Gene: Patl_2259: Siderophore-interacting protein Gene: Patl_0871: Siderophore-interacting protein |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -53 score = 5.10316 sequence = TAATGAGAATCATTAACAAAT Gene: MADE_03816: Siderophore-interacting protein |
|
|
Gene: ATW7_00540: Siderophore-interacting protein |
Gene: PSHAb0539: Siderophore-interacting protein |
Gene: PTD2_22232: Siderophore-interacting protein |
|
|
Siderophore-interacting protein |
| CRON 19. | ||||||||||
| CPS_4959 |
|
|
|
Gene: CPS_4959: Ferrichrome-iron receptor |
*
Alteromonadales bacterium TW-7 Site: position = -67 score = 5.69498 sequence = AAATGATATTTATTTTTATTA Gene: ATW7_15529: Ferrichrome-iron receptor |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -62 score = 5.51519 sequence = AAATGATACTGGTTTTCATTA Gene: PSHAa0108: Ferrichrome-iron receptor |
|
|
|
Ferrichrome-iron receptor |
| CRON 20. | ||||||||||
| OS145_11766 |
|
|
|
|
|
|
|
*
Idiomarina baltica OS145 Site: position = -63 score = 5.30355 sequence = ATTTGATAATTGTTCTTATTA Gene: OS145_11766: putative iron-regulated membrane protein |
*
Idiomarina loihiensis L2TR Site: position = -58 score = 5.09626 sequence = ATTTGATAATTGTTCGTATTT Site: position = -85 score = 5.36611 sequence = AAATGAGAATTGTTCGCAACA Gene: IL2512: putative iron-regulated membrane protein |
putative iron-regulated membrane protein |
| OS145_11761 |
|
|
|
|
|
|
|
Gene: OS145_11761: hypothetical protein |
Gene: IL2513: hypothetical protein |
hypothetical protein |
| CRON 21. | ||||||||||
| IL1578 |
|
|
|
|
|
|
|
|
*
Idiomarina loihiensis L2TR Site: position = -105 score = 6.15736 sequence = AAATGATAATGGTTTTCATTA Gene: IL1578: putative iron-regulated membrane protein |
putative iron-regulated membrane protein |
| CRON 22. | ||||||||||
| Patl_1817 |
Gene: Patl_1817: Uncharacterized protein conserved in bacteria |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -72 score = 4.79506 sequence = AAGTATAAATTATTTTTATTT Gene: MADE_02492: Uncharacterized protein conserved in bacteria |
|
Gene: CPS_2824: Uncharacterized protein conserved in bacteria |
|
|
Gene: PTD2_01891: Uncharacterized protein conserved in bacteria |
Gene: OS145_01642: Uncharacterized protein conserved in bacteria |
*
Idiomarina loihiensis L2TR Site: position = -59 score = 6.15736 sequence = TAATGAAAACCATTATCATTT Gene: IL1577: Uncharacterized protein conserved in bacteria |
Uncharacterized protein conserved in bacteria |
| MADE_01572 |
|
Gene: MADE_01572: TonB-dependent receptor, putative |
|
|
Gene: ATW7_12708: TonB-dependent receptor, putative |
|
|
Gene: OS145_05835: TonB-dependent receptor, putative |
Gene: IL1576: TonB-dependent receptor, putative |
TonB-dependent receptor, putative |
| CRON 23. | ||||||||||
| PTD2_00731 |
|
|
|
|
|
|
*
Pseudoalteromonas tunicata D2 Site: position = -43 score = 6.02454 sequence = AAATGATAATTGATATCATTT Gene: PTD2_00731: Iron-regulated outer membrane protein |
|
|
Iron-regulated outer membrane protein |
| CRON 24. | ||||||||||
| Patl_1443 |
*
Pseudoalteromonas atlantica T6c Site: position = -93 score = 4.7438 sequence = AAATTCAAATGATATTCATTA Site: position = -87 score = 6.01075 sequence = AAATGATATTCATTATCATTA Gene: Patl_1443: Ferrichrome-iron receptor |
|
|
|
|
|
|
|
|
Ferrichrome-iron receptor |
| Patl_1444 |
Gene: Patl_1444: putative iron-regulated membrane protein |
|
|
|
|
|
|
|
|
putative iron-regulated membrane protein |
| CRON 25. | ||||||||||
| IL0795 |
|
|
|
|
|
|
|
|
*
Idiomarina loihiensis L2TR Site: position = -67 score = 5.98863 sequence = AATTGATAATAGTTATCATTA Gene: IL0795: Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid |
Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid |
| CRON 26. | ||||||||||
| hmuR |
|
|
|
|
|
Gene: PSHAb0072: TonB-dependent hemin , ferrichrome receptor |
*
Pseudoalteromonas tunicata D2 Site: position = -94 score = 5.94187 sequence = AAATGATAATACTTCTCATTA Gene: PTD2_10208: TonB-dependent hemin , ferrichrome receptor |
|
|
TonB-dependent hemin , ferrichrome receptor |
| hmuS |
|
|
|
|
|
Gene: PSHAb0073: Hemin transport protein HmuS |
Gene: PTD2_10213: Hemin transport protein HmuS |
|
|
Hemin transport protein HmuS |
| CRON 27. | ||||||||||
| PTD2_00706 |
|
|
|
|
|
|
*
Pseudoalteromonas tunicata D2 Site: position = -128 score = 5.90957 sequence = AAATGATAACAATTACCATTT Gene: PTD2_00706: Vibriobactin receptor precursor |
|
|
Vibriobactin receptor precursor |
| CRON 28. | ||||||||||
| piu |
*
Pseudoalteromonas atlantica T6c Site: position = -51 score = 5.62153 sequence = TAATGAGAATGCTTCTTATTT Gene: Patl_3414: Putaive Fe-regulated protein B |
|
|
|
|
|
|
|
*
Idiomarina loihiensis L2TR Site: position = -52 score = 4.70636 sequence = ACAATATAATCATTCTCATTT Gene: IL0069: Putaive Fe-regulated protein B |
Putaive Fe-regulated protein B |
| piuB |
Gene: Patl_3413: Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB |
|
|
Gene: CPS_4883: Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB |
|
|
|
|
|
Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB |
| CRON 29. | ||||||||||
| PTD2_05935 |
|
|
|
|
|
|
*
Pseudoalteromonas tunicata D2 Site: position = -2 score = 5.55282 sequence = AAATGATAACGATTAACATTA Gene: PTD2_05935: Ferrichrome-iron receptor |
|
|
Ferrichrome-iron receptor |
| PTD2_05930 |
|
|
|
|
|
|
Gene: PTD2_05930: Iron-uptake factor PiuC |
|
|
Iron-uptake factor PiuC |
| CRON 30. | ||||||||||
| ATW7_05436 |
|
|
|
|
*
Alteromonadales bacterium TW-7 Site: position = -89 score = 4.75429 sequence = AAATAATAACAACTATTAATA Gene: ATW7_05436: putative orphan protein; putative conserved domain |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -34 score = 4.75845 sequence = TAATAATAATTATTAATAATA Site: position = -37 score = 5.55178 sequence = AAATAATAATAATTATTAATA Gene: PSHAa0951: diguanylate cyclase/phosphodiesterase (GGDEF & EAL domains) with PAS/PAC sensor(s) |
Gene: PTD2_15542: diguanylate cyclase/phosphodiesterase (GGDEF & EAL domains) with PAS/PAC sensor(s) |
|
|
putative orphan protein; putative conserved domain |
| CRON 31. | ||||||||||
| IL0109 |
|
|
|
|
|
|
|
|
*
Idiomarina loihiensis L2TR Site: position = -177 score = 5.47754 sequence = TATTGATACTGATTCTCATTT Gene: IL0109: Probable TonB-dependent receptor |
Probable TonB-dependent receptor |
| CRON 32. | ||||||||||
| MADE_02662 |
|
*
Alteromonas macleodii 'Deep ecotype' Site: position = -117 score = 5.46922 sequence = AAATAACAACTATTATTATTT Gene: MADE_02662: putative TonB-dependent receptor |
|
|
|
|
|
|
|
putative TonB-dependent receptor |
| CRON 33. | ||||||||||
| hugA |
|
|
|
*
Colwellia psychrerythraea 34H Site: position = -43 score = 5.4447 sequence = AGATCATAATGATTCTTATTT Gene: CPS_1858: Heme transport protein |
|
|
|
|
|
Heme transport protein |
| CRON 34. | ||||||||||
| fhuA |
|
|
|
|
|
|
|
|
*
Idiomarina loihiensis L2TR Site: position = -66 score = 5.3999 sequence = AAACGCGAATCGTTTTCATTT Gene: IL2514: Ferrichrome-iron receptor |
Ferrichrome-iron receptor |
| CRON 35. | ||||||||||
| sodA |
|
|
|
|
|
|
|
|
*
Idiomarina loihiensis L2TR Site: position = -52 score = 4.77727 sequence = AAATGCAAATGATAATGATTA Site: position = -46 score = 5.35606 sequence = AAATGATAATGATTACCGTTA Gene: IL0798: Manganese superoxide dismutase (EC 1.15.1.1) |
Manganese superoxide dismutase (EC 1.15.1.1) |
| IL0799 |
|
|
|
|
|
|
|
|
Gene: IL0799: Metal transporter, ZIP family |
Metal transporter, ZIP family |
| CRON 36. | ||||||||||
| ATW7_04502 |
|
|
|
|
*
Alteromonadales bacterium TW-7 Site: position = -67 score = 5.31494 sequence = AAATGATAATTGTTGCTATTT Gene: ATW7_04502: Ferrichrome-iron receptor |
|
*
Pseudoalteromonas tunicata D2 Site: position = -75 score = 4.53822 sequence = AAATGAGAATATATACTATTC Gene: PTD2_05440: Ferrichrome-iron receptor |
|
|
Ferrichrome-iron receptor |
| CRON 37. | ||||||||||
| PTD2_01211 |
|
|
|
|
|
|
*
Pseudoalteromonas tunicata D2 Site: position = 4 score = 5.18142 sequence = AAATGATAACAGTTATCATGC Gene: PTD2_01211: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins |
|
|
TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins |
| CRON 38. | ||||||||||
| fhuE_1 |
|
|
|
|
|
|
|
|
*
Idiomarina loihiensis L2TR Site: position = -66 score = 5.18443 sequence = AAATGATAACGATTCGTAGTT Gene: IL1581: Putative OMR family iron-siderophore receptor precursor |
Putative OMR family iron-siderophore receptor precursor |
| CRON 39. | ||||||||||
| ATW7_00730 |
|
|
|
|
*
Alteromonadales bacterium TW-7 Site: position = -61 score = 5.11584 sequence = AAATAGAAATCATTACCATTA Gene: ATW7_00730: Siderophore biosynthesis L-2,4-diaminobutyrate decarboxylase |
|
*
Pseudoalteromonas tunicata D2 Site: position = -123 score = 4.53822 sequence = GAATAGTATATATTCTCATTT Gene: PTD2_05445: Siderophore biosynthesis L-2,4-diaminobutyrate decarboxylase |
|
|
Siderophore biosynthesis L-2,4-diaminobutyrate decarboxylase |
| ATW7_00735 |
|
|
|
|
Gene: ATW7_00735: Siderophore biosynthesis protein, monooxygenase |
|
Gene: PTD2_05450: Siderophore biosynthesis protein, monooxygenase |
|
|
Siderophore biosynthesis protein, monooxygenase |
| ATW7_00740 |
|
|
|
|
Gene: ATW7_00740: Siderophore related permease |
|
Gene: PTD2_05455: Siderophore related permease |
|
|
Siderophore related permease |
| CRON 40. | ||||||||||
| PTD2_14219 |
|
|
|
|
|
|
*3
Pseudoalteromonas tunicata D2 Gene: PTD2_14219: TonB-dependent receptor Site: position = 6 score = 5.05656 sequence = AAATTAAATTTATTAGCAATT Gene: PTD2_06379: TonB-dependent receptor Gene: PTD2_06369: TonB-dependent receptor |
|
|
TonB-dependent receptor |
| CRON 41. | ||||||||||
| CPS_4762 |
|
|
|
Gene: CPS_4762: Ferric siderophore transport system, periplasmic binding protein TonB |
*
Alteromonadales bacterium TW-7 Site: position = -257 score = 5.02491 sequence = TAATGACAATAGCTATCATCT Gene: ATW7_11686: Ferric siderophore transport system, periplasmic binding protein TonB |
Gene: PSHAa0528: Ferric siderophore transport system, periplasmic binding protein TonB |
|
|
|
Ferric siderophore transport system, periplasmic binding protein TonB |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |