Regulon of Fur in Pseudoalteromonas tunicata D2

Properties
Regulator type:	Transcription factor
TF locus tag:	PTD2_19320
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Alteromonadales
Statistics of regulated genes:
- Genes	40
- Operons	20
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 142 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -75 Score: 4.5 Sequence: AAATGAGAATATATACTATTC Locus tag: PTD2_05440 Name: null Funciton: Ferrichrome-iron receptor
	PTD2_05440		Ferrichrome-iron receptor
Position: 4 Score: 5.2 Sequence: AAATGATAACAGTTATCATGC Locus tag: PTD2_01211 Name: null Funciton: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
	PTD2_01211		TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
Position: -162 Score: 5.8 Sequence: AAATAATAACCATTATCAATT Locus tag: PTD2_16666 Name: CPS_1855 Funciton: conserved protein of unknown function; putative membrane-associated protein Locus tag: PTD2_16671 Name: CPS_1856 Funciton: putative exported protein Locus tag: PTD2_16676 Name: ATW7_15889 Funciton: Uncharacterized metal-binding protein
	PTD2_16666	CPS_1855	conserved protein of unknown function; putative membrane-associated protein
	PTD2_16671	CPS_1856	putative exported protein
	PTD2_16676	ATW7_15889	Uncharacterized metal-binding protein
Position: -66 Score: 6.3 Sequence: AATTGATAATAATTATCATTT Locus tag: PTD2_04291 Name: fhuE Funciton: TonB-dependent siderophore receptor Locus tag: PTD2_04296 Name: pepSY Funciton: putative iron-regulated membrane protein
	PTD2_04291	fhuE	TonB-dependent siderophore receptor
	PTD2_04296	pepSY	putative iron-regulated membrane protein
Position: -123 Score: 4.5 Sequence: GAATAGTATATATTCTCATTT Locus tag: PTD2_05445 Name: ATW7_00730 Funciton: Siderophore biosynthesis L-2,4-diaminobutyrate decarboxylase Locus tag: PTD2_05450 Name: ATW7_00735 Funciton: Siderophore biosynthesis protein, monooxygenase Locus tag: PTD2_05455 Name: ATW7_00740 Funciton: Siderophore related permease
	PTD2_05445	ATW7_00730	Siderophore biosynthesis L-2,4-diaminobutyrate decarboxylase
	PTD2_05450	ATW7_00735	Siderophore biosynthesis protein, monooxygenase
	PTD2_05455	ATW7_00740	Siderophore related permease
Position: -85 Score: 6 Sequence: AAATGATATTTATTATCATTA Position: -29 Score: 5.9 Sequence: AAATAAGATTTATTATCATTT Locus tag: PTD2_09069 Name: null Funciton: Iron-regulated protein A precursor Locus tag: PTD2_09074 Name: CPS_0695 Funciton: Probable thiol oxidoreductase with 2 cytochrome c heme-binding sites Locus tag: PTD2_09079 Name: null Funciton: Probable thiol oxidoreductase with 2 cytochrome c heme-binding sites Locus tag: PTD2_09084 Name: irpA Funciton: Iron-regulated protein A precursor
	PTD2_09069		Iron-regulated protein A precursor
	PTD2_09074	CPS_0695	Probable thiol oxidoreductase with 2 cytochrome c heme-binding sites
	PTD2_09079		Probable thiol oxidoreductase with 2 cytochrome c heme-binding sites
	PTD2_09084	irpA	Iron-regulated protein A precursor
Position: -158 Score: 4.8 Sequence: AAATAAAAATAATACTTATCA Position: -155 Score: 4.6 Sequence: TAAAAATAATACTTATCATAT Position: -82 Score: 5.5 Sequence: TAATGAGATTGATTATCATTG Locus tag: PTD2_15697 Name: null Funciton: VCBS Locus tag: PTD2_15702 Name: irpA Funciton: Iron-regulated protein A precursor Locus tag: PTD2_15707 Name: fecA Funciton: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
	PTD2_15697		VCBS
	PTD2_15702	irpA	Iron-regulated protein A precursor
	PTD2_15707	fecA	TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
Position: -83 Score: 5.2 Sequence: AAATGAGAATTACTATCTTTT Locus tag: PTD2_01631 Name: ATW7_00890 Funciton: iron uptake protein Locus tag: PTD2_01626 Name: pepSY Funciton: iron-regulated membrane protein Locus tag: PTD2_01621 Name: ATW7_00900 Funciton: iron uptake protein
	PTD2_01631	ATW7_00890	iron uptake protein
	PTD2_01626	pepSY	iron-regulated membrane protein
	PTD2_01621	ATW7_00900	iron uptake protein
Position: -92 Score: 5 Sequence: AAATAATAATTATTCGTATAA Position: -47 Score: 5.6 Sequence: AACTGATAATTATTATCATTC Locus tag: PTD2_20667 Name: COG4774 Funciton: Outer membrane receptor for monomeric catechols, TonB-dependent
	PTD2_20667	COG4774	Outer membrane receptor for monomeric catechols, TonB-dependent
Position: -23 Score: 5.9 Sequence: AAATAAAAACAATTATCATTA Locus tag: PTD2_01521 Name: Patl_2402 Funciton: Ferric aerobactin receptor
	PTD2_01521	Patl_2402	Ferric aerobactin receptor
Position: -76 Score: 5.9 Sequence: TAATGAGAAGTATTATCATTT Locus tag: PTD2_10203 Name: hmuT Funciton: Hemin ABC transporter, periplasmic component Locus tag: PTD2_10198 Name: hmuU Funciton: Hemin ABC transporter, permease protein Locus tag: PTD2_10193 Name: hmuV Funciton: Hemin ABC transporter, ATP-binding protein
	PTD2_10203	hmuT	Hemin ABC transporter, periplasmic component
	PTD2_10198	hmuU	Hemin ABC transporter, permease protein
	PTD2_10193	hmuV	Hemin ABC transporter, ATP-binding protein
Position: -66 Score: 6.2 Sequence: AAATGATATTGATTATCATTT Locus tag: PTD2_19380 Name: PF11449 Funciton: Predicted manganese transporter, 11 TMS
	PTD2_19380	PF11449	Predicted manganese transporter, 11 TMS
Position: 6 Score: 5.1 Sequence: AAATTAAATTTATTAGCAATT Locus tag: PTD2_06379 Name: null Funciton: TonB-dependent receptor
	PTD2_06379		TonB-dependent receptor
Position: -157 Score: 4.9 Sequence: AAATAACAATAATTGTTATTC Locus tag: PTD2_02826 Name: bfr2 Funciton: Bacterioferritin, subunit 2 Locus tag: PTD2_02821 Name: bfr1 Funciton: Bacterioferritin subunit 1
	PTD2_02826	bfr2	Bacterioferritin, subunit 2
	PTD2_02821	bfr1	Bacterioferritin subunit 1
Position: -33 Score: 5.6 Sequence: ATTTGATAATAATTCTTATTT Locus tag: PTD2_08484 Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein Locus tag: PTD2_08489 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein Locus tag: PTD2_08494 Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein Locus tag: PTD2_08499 Name: yfeK Funciton: Predicted iron-dependent peroxidase, Dyp-type family
	PTD2_08484	fbpA	Ferric iron ABC transporter, iron-binding protein
	PTD2_08489	fbpB	Ferric iron ABC transporter, permease protein
	PTD2_08494	fbpC	Ferric iron ABC transporter, ATP-binding protein
	PTD2_08499	yfeK	Predicted iron-dependent peroxidase, Dyp-type family
Position: -64 Score: 5.8 Sequence: TATTGAAAATGATTGTCATTT Locus tag: PTD2_08349 Name: bfd Funciton: Bacterioferritin-associated ferredoxin
	PTD2_08349	bfd	Bacterioferritin-associated ferredoxin
Position: -94 Score: 5.9 Sequence: AAATGATAATACTTCTCATTA Locus tag: PTD2_10208 Name: null Funciton: TonB-dependent hemin , ferrichrome receptor Locus tag: PTD2_10213 Name: null Funciton: Hemin transport protein HmuS
	PTD2_10208		TonB-dependent hemin , ferrichrome receptor
	PTD2_10213		Hemin transport protein HmuS
Position: -43 Score: 6 Sequence: AAATGATAATTGATATCATTT Locus tag: PTD2_00731 Name: null Funciton: Iron-regulated outer membrane protein
	PTD2_00731		Iron-regulated outer membrane protein
Position: -128 Score: 5.9 Sequence: AAATGATAACAATTACCATTT Locus tag: PTD2_00706 Name: null Funciton: Vibriobactin receptor precursor
	PTD2_00706		Vibriobactin receptor precursor
Position: -2 Score: 5.6 Sequence: AAATGATAACGATTAACATTA Locus tag: PTD2_05935 Name: null Funciton: Ferrichrome-iron receptor Locus tag: PTD2_05930 Name: null Funciton: Iron-uptake factor PiuC
	PTD2_05935		Ferrichrome-iron receptor
	PTD2_05930		Iron-uptake factor PiuC

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Pseudoalteromonas tunicata D2

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --