Regulon of Fur in Pseudoalteromonas haloplanktis TAC125

Properties
Regulator type:	Transcription factor
TF locus tag:	PSHAa1641
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Alteromonadales
Statistics of regulated genes:
- Genes	23
- Operons	15
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 142 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -65 Score: 5.6 Sequence: AATTGCAAATCAATATCATTT Locus tag: PSHAa0695 Name: fhuE Funciton: TonB-dependent siderophore receptor
	PSHAa0695	fhuE	TonB-dependent siderophore receptor
Position: -78 Score: 4.7 Sequence: GAATAACATTGATTCTCATTC Locus tag: PSHAa2478 Name: fecA Funciton: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
	PSHAa2478	fecA	TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
Position: -55 Score: 5.2 Sequence: TAACGATAACCATTATCATTC Position: -22 Score: 4.8 Sequence: AAATACGAATACTTACCATTA Locus tag: PSHAb0512 Name: COG4774 Funciton: Outer membrane receptor for monomeric catechols, TonB-dependent
	PSHAb0512	COG4774	Outer membrane receptor for monomeric catechols, TonB-dependent
Position: -49 Score: 5.2 Sequence: TATTGTTAATAGTTATCATTA Locus tag: PSHAb0286 Name: Patl_2402 Funciton: Ferric aerobactin receptor
	PSHAb0286	Patl_2402	Ferric aerobactin receptor
Position: -149 Score: 5.1 Sequence: AATTGAAAACTGCTCTCATTA Locus tag: PSHAb0287 Name: pepSY Funciton: Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB
	PSHAb0287	pepSY	Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB
Position: -67 Score: 6.2 Sequence: AAATGATATTGATTATCATTT Locus tag: PSHAa1629 Name: PF11449 Funciton: Predicted manganese transporter, 11 TMS
	PSHAa1629	PF11449	Predicted manganese transporter, 11 TMS
Position: -147 Score: 5.6 Sequence: TAATGATAACTATTATCAAAT Locus tag: PSHAa0048 Name: fumC Funciton: Fumarate hydratase class II (EC 4.2.1.2)
	PSHAa0048	fumC	Fumarate hydratase class II (EC 4.2.1.2)
Position: -52 Score: 5.1 Sequence: AATTGATAATTGTTATCATGC Locus tag: PSHAa2961 Name: pepSY Funciton: putative iron-regulated membrane protein
	PSHAa2961	pepSY	putative iron-regulated membrane protein
Position: -32 Score: 5.3 Sequence: TATTGATAATAGTTATTATTC Locus tag: PSHAa2663 Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein Locus tag: PSHAa2662 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein Locus tag: PSHAa2661 Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein Locus tag: PSHAa2660 Name: yfeK Funciton: Predicted iron-dependent peroxidase, Dyp-type family
	PSHAa2663	fbpA	Ferric iron ABC transporter, iron-binding protein
	PSHAa2662	fbpB	Ferric iron ABC transporter, permease protein
	PSHAa2661	fbpC	Ferric iron ABC transporter, ATP-binding protein
	PSHAa2660	yfeK	Predicted iron-dependent peroxidase, Dyp-type family
Position: -56 Score: 4.9 Sequence: AAATGAGAGTGGTTAGCATTC Locus tag: PSHAb0279 Name: Patl_1142 Funciton: TonB-dependent siderophore receptor
	PSHAb0279	Patl_1142	TonB-dependent siderophore receptor
Position: -62 Score: 5.5 Sequence: AAATGATACTGGTTTTCATTA Locus tag: PSHAa0108 Name: CPS_4959 Funciton: Ferrichrome-iron receptor
	PSHAa0108	CPS_4959	Ferrichrome-iron receptor
Position: -37 Score: 5.6 Sequence: AAATAATAATAATTATTAATA Position: -34 Score: 4.8 Sequence: TAATAATAATTATTAATAATA Locus tag: PSHAa0951 Name: null Funciton: diguanylate cyclase/phosphodiesterase (GGDEF & EAL domains) with PAS/PAC sensor(s)
	PSHAa0951		diguanylate cyclase/phosphodiesterase (GGDEF & EAL domains) with PAS/PAC sensor(s)
Position: -49 Score: 5 Sequence: TAATACAAATCATTATCATGT Locus tag: PSHAa2970 Name: CPS_1855 Funciton: conserved protein of unknown function; putative membrane-associated protein Locus tag: PSHAa2971 Name: CPS_1856 Funciton: putative exported protein Locus tag: PSHAa2972 Name: ATW7_15889 Funciton: Uncharacterized metal-binding protein
	PSHAa2970	CPS_1855	conserved protein of unknown function; putative membrane-associated protein
	PSHAa2971	CPS_1856	putative exported protein
	PSHAa2972	ATW7_15889	Uncharacterized metal-binding protein
Position: -47 Score: 5.9 Sequence: AAATGCTAATCATTATCAATT Locus tag: PSHAb0251 Name: irgA Funciton: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
	PSHAb0251	irgA	TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
Position: -45 Score: 5.1 Sequence: ATATGATAATACCTATCATTT Locus tag: PSHAa1611 Name: null Funciton: putative orphan protein Locus tag: PSHAa1612 Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein Locus tag: PSHAa1613 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein Locus tag: PSHAa1614 Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein
	PSHAa1611		putative orphan protein
	PSHAa1612	fbpA	Ferric iron ABC transporter, iron-binding protein
	PSHAa1613	fbpB	Ferric iron ABC transporter, permease protein
	PSHAa1614	fbpC	Ferric iron ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Pseudoalteromonas haloplanktis TAC125

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --