Regulon of Fur in Alteromonas macleodii 'Deep ecotype'

Properties
Regulator type:	Transcription factor
TF locus tag:	MADE_01084
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Alteromonadales
Statistics of regulated genes:
- Genes	14
- Operons	10
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 142 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: 5 Score: 5.7 Sequence: TAATGATAATAAGTATCATTT Locus tag: MADE_00161 Name: null Funciton: putative orphan protein Locus tag: MADE_00162 Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein Locus tag: MADE_00163 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein Locus tag: MADE_00164 Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein
	MADE_00161		putative orphan protein
	MADE_00162	fbpA	Ferric iron ABC transporter, iron-binding protein
	MADE_00163	fbpB	Ferric iron ABC transporter, permease protein
	MADE_00164	fbpC	Ferric iron ABC transporter, ATP-binding protein
Position: -102 Score: 5.5 Sequence: AAATAGCAATAATTATCATTT Locus tag: MADE_00133 Name: fhuE Funciton: TonB-dependent siderophore receptor
	MADE_00133	fhuE	TonB-dependent siderophore receptor
Position: -39 Score: 5.6 Sequence: AAACGCAAATCATTATCATTT Position: -33 Score: 4.8 Sequence: AAATCATTATCATTTGCATTA Locus tag: MADE_01534 Name: COG4771 Funciton: Outer membrane receptor for ferrienterochelin, TonB-dependent
	MADE_01534	COG4771	Outer membrane receptor for ferrienterochelin, TonB-dependent
Position: -8 Score: 6 Sequence: AAATGCTAATGGTTATCATTT Locus tag: MADE_01602 Name: null Funciton: hypothetical protein Locus tag: MADE_01603 Name: fumC Funciton: Fumarate hydratase class II (EC 4.2.1.2)
	MADE_01602		hypothetical protein
	MADE_01603	fumC	Fumarate hydratase class II (EC 4.2.1.2)
Position: -65 Score: 6.1 Sequence: AATTGATAATAATTCTCATTA Locus tag: MADE_02392 Name: COG3205 Funciton: membrane protein
	MADE_02392	COG3205	membrane protein
Position: -53 Score: 5.1 Sequence: TAATGAGAATCATTAACAAAT Locus tag: MADE_03816 Name: Patl_0871 Funciton: Siderophore-interacting protein
	MADE_03816	Patl_0871	Siderophore-interacting protein
Position: -251 Score: 5.1 Sequence: AAATGATAATAATTGCTATTC Locus tag: MADE_02743 Name: ahpCB Funciton: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
	MADE_02743	ahpCB	Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
Position: -117 Score: 5.5 Sequence: AAATAACAACTATTATTATTT Locus tag: MADE_02662 Name: null Funciton: putative TonB-dependent receptor
	MADE_02662		putative TonB-dependent receptor
Position: -57 Score: 5.1 Sequence: GAATAGCAATTATTATCATTT Locus tag: MADE_02744 Name: bfd Funciton: Bacterioferritin-associated ferredoxin
	MADE_02744	bfd	Bacterioferritin-associated ferredoxin
Position: -72 Score: 4.8 Sequence: AAGTATAAATTATTTTTATTT Locus tag: MADE_02492 Name: Patl_1817 Funciton: Uncharacterized protein conserved in bacteria
	MADE_02492	Patl_1817	Uncharacterized protein conserved in bacteria

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Alteromonas macleodii 'Deep ecotype'

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --