Regulon of Fur in Glaciecola sp. HTCC2999

Properties
Regulator type:	Transcription factor
TF locus tag:	GHTCC_010100006492
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Alteromonadales
Statistics of regulated genes:
- Genes	6
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 142 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -61 Score: 5.8 Sequence: TATTGAGAATTATTCTCAATA Locus tag: GHTCC_010100005814 Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein Locus tag: GHTCC_010100005809 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein Locus tag: GHTCC_010100005804 Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein
	GHTCC_010100005814	fbpA	Ferric iron ABC transporter, iron-binding protein
	GHTCC_010100005809	fbpB	Ferric iron ABC transporter, permease protein
	GHTCC_010100005804	fbpC	Ferric iron ABC transporter, ATP-binding protein
Position: -85 Score: 5.9 Sequence: AATTGAGATTGATTCTCATTT Locus tag: GHTCC_010100005799 Name: fecA Funciton: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
	GHTCC_010100005799	fecA	TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins
Position: -171 Score: 5.9 Sequence: TAATAATAATAGTTCTCATTT Locus tag: GHTCC_010100007527 Name: ahpCB Funciton: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
	GHTCC_010100007527	ahpCB	Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
Position: -46 Score: 5.9 Sequence: AAATGAGAACTATTATTATTA Locus tag: GHTCC_010100007522 Name: bfd Funciton: Bacterioferritin-associated ferredoxin
	GHTCC_010100007522	bfd	Bacterioferritin-associated ferredoxin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD