Regulog IscR - Vibrionales

Properties
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Phylum:	Proteobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 39 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Statistics of regulated genes
Genome	Genes	Operons
Vibrio cholerae O1 biovar eltor str. N16961	10	3
Vibrio vulnificus CMCP6	10	3
Vibrio harveyi ATCC BAA-1116	10	3
Vibrio parahaemolyticus RIMD 2210633	10	3
Vibrio shilonii AK1	10	3
Vibrio splendidus LGP32	9	2
Vibrio fischeri ES114	10	3
Vibrio salmonicida LFI1238	10	3
Vibrio angustum S14	10	3
Photobacterium profundum SS9	10	3

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes											Function

CRON 1.
erpA	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -114 score = 5.24488 sequence = ATACTTGAACGGCCAACTCAGGTAT Gene: VC0627: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Vibrio vulnificus CMCP6 Site: position = -175 score = 6.86147 sequence = ATACTTGAACGTATTGGTCAGGTAT Gene: VV1_1679: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Vibrio harveyi ATCC BAA-1116 Site: position = -87 score = 6.70416 sequence = ATACTTGAACGAGTTTGTCAGGTAT Gene: VIBHAR_03416: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -103 score = 6.70416 sequence = ATACTTGAACGAGTTTGTCAGGTAT Gene: VP2474: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Vibrio shilonii AK1 Site: position = -169 score = 6.69545 sequence = ATACTTGAACGAAGCAGTCAGGTAT Gene: VSAK1_05110: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Vibrio splendidus LGP32 Site: position = -87 score = 6.82803 sequence = ATACTTGAACGTTTCAGTCAGGTAT Gene: VS_2501: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Vibrio fischeri ES114 Site: position = -75 score = 6.95769 sequence = ATACTTGAATGAAACAGTCAGGTAT Gene: VF_2134: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Vibrio salmonicida LFI1238 Site: position = -75 score = 6.95769 sequence = ATACTTGAATGAAACAGTCAGGTAT Gene: VSAL_I2571: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Vibrio angustum S14 Site: position = -68 score = 7.00705 sequence = ATACTTGAACAACATAGTCAGGTAT Gene: VAS14_07789: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Photobacterium profundum SS9 Site: position = -68 score = 7.13274 sequence = ATACTTGAACAAGTTAGTCAGGTAT Gene: PBPRA0531: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family

CRON 2.
iscR	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -23 score = 6.88847 sequence = ATACTTGACCAAAAGAGTCAAGTAT Site: position = -48 score = 6.88519 sequence = ATACCTGACTAAATTAGTCAAATAA Gene: VC0747: Iron-sulfur cluster regulator IscR	* Vibrio vulnificus CMCP6 Site: position = -93 score = 6.70813 sequence = ATACCTGACTATTTTAGTCAAATAA Site: position = -68 score = 7.02961 sequence = ATACTTGACCATTTTGGTCAGGTAT Gene: VV1_0439: Iron-sulfur cluster regulator IscR	* Vibrio harveyi ATCC BAA-1116 Site: position = -93 score = 6.86587 sequence = ATACCTGACTAAAATAGTCAAATAA Site: position = -68 score = 6.7275 sequence = ATACTTGACCGTTTTGGTCGGGTAT Gene: VIBHAR_01054: Iron-sulfur cluster regulator IscR	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -93 score = 6.49644 sequence = ATACCTGAGTAATTTAGTCAAATAA Site: position = -68 score = 6.68394 sequence = ATACTTGACCATTTTACTCGGGTAT Gene: VP0595: Iron-sulfur cluster regulator IscR	* Vibrio shilonii AK1 Site: position = -91 score = 6.70813 sequence = ATACCTGACTATTTTAGTCAAATAA Site: position = -66 score = 7.04713 sequence = ATACTTGATTAAAATAGTCAGGTAT Gene: VSAK1_12120: Iron-sulfur cluster regulator IscR	* Vibrio splendidus LGP32 Site: position = -92 score = 6.65696 sequence = ATACCTGACTAAAATAGTCAACTAA Site: position = -67 score = 7.20203 sequence = ATACTTGACCAATTTAGTCGGGTAT Gene: VS_0606: Iron-sulfur cluster regulator IscR	* Vibrio fischeri ES114 Site: position = -69 score = 7.40966 sequence = ATACTTGACCAAAATAGTCAGGTAT Site: position = -94 score = 6.30175 sequence = GTACTTGACTAAAATAGTAGGATAA Gene: VF_0616: Iron-sulfur cluster regulator IscR	* Vibrio salmonicida LFI1238 Site: position = -69 score = 7.18734 sequence = ATACTTGACCAAAATGGTCAGGTAT Site: position = -94 score = 6.69708 sequence = ATACTTGACTAAAATAGTAGGATAA Gene: VSAL_I0716: Iron-sulfur cluster regulator IscR	* Vibrio angustum S14 Site: position = -103 score = 6.73401 sequence = ATACTTGACCAATTTAGTATGGTAT Site: position = -128 score = 5.82461 sequence = ATACCCTACTAGAACAGTCAGGTAA Gene: VAS14_06718: Iron-sulfur cluster regulator IscR	* Photobacterium profundum SS9 Site: position = -66 score = 7.07927 sequence = ATACTTGACCATTTTAGTCGGGTAT Site: position = -91 score = 6.4083 sequence = AAACCTGACTAAAATCGTCAGGTAA Gene: PBPRA0749: Iron-sulfur cluster regulator IscR	Iron-sulfur cluster regulator IscR
iscS	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC0748: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Vibrio vulnificus CMCP6 Gene: VV1_0438: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_01055: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Vibrio parahaemolyticus RIMD 2210633 Gene: VP0596: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Vibrio shilonii AK1 Gene: VSAK1_12115: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Vibrio splendidus LGP32 Gene: VS_0607: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Vibrio fischeri ES114 Gene: VF_0617: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Vibrio salmonicida LFI1238 Gene: VSAL_I0717: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Vibrio angustum S14 Gene: VAS14_06713: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Photobacterium profundum SS9 Gene: PBPRA0750: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC0749: Iron-sulfur cluster assembly scaffold protein IscU	Vibrio vulnificus CMCP6 Gene: VV1_0437: Iron-sulfur cluster assembly scaffold protein IscU	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_01056: Iron-sulfur cluster assembly scaffold protein IscU	Vibrio parahaemolyticus RIMD 2210633 Gene: VP0597: Iron-sulfur cluster assembly scaffold protein IscU	Vibrio shilonii AK1 Gene: VSAK1_12110: Iron-sulfur cluster assembly scaffold protein IscU	Vibrio splendidus LGP32 Gene: VS_0608: Iron-sulfur cluster assembly scaffold protein IscU	Vibrio fischeri ES114 Gene: VF_0618: Iron-sulfur cluster assembly scaffold protein IscU	Vibrio salmonicida LFI1238 Gene: VSAL_I0718: Iron-sulfur cluster assembly scaffold protein IscU	Vibrio angustum S14 Gene: VAS14_06708: Iron-sulfur cluster assembly scaffold protein IscU	Photobacterium profundum SS9 Gene: PBPRA0751: Iron-sulfur cluster assembly scaffold protein IscU	Iron-sulfur cluster assembly scaffold protein IscU
iscA	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC0750: Iron binding protein IscA for iron-sulfur cluster assembly	Vibrio vulnificus CMCP6 Gene: VV1_0436: Iron binding protein IscA for iron-sulfur cluster assembly	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_01057: Iron binding protein IscA for iron-sulfur cluster assembly	Vibrio parahaemolyticus RIMD 2210633 Gene: VP0598: Iron binding protein IscA for iron-sulfur cluster assembly	Vibrio shilonii AK1 Gene: VSAK1_12105: Iron binding protein IscA for iron-sulfur cluster assembly	Vibrio splendidus LGP32 Gene: VS_0609: Iron binding protein IscA for iron-sulfur cluster assembly	Vibrio fischeri ES114 Gene: VF_0619: Iron binding protein IscA for iron-sulfur cluster assembly	Vibrio salmonicida LFI1238 Gene: VSAL_I0719: Iron binding protein IscA for iron-sulfur cluster assembly	Vibrio angustum S14 Gene: VAS14_06703: Iron binding protein IscA for iron-sulfur cluster assembly	Photobacterium profundum SS9 Gene: PBPRA0752: Iron binding protein IscA for iron-sulfur cluster assembly	Iron binding protein IscA for iron-sulfur cluster assembly
hscB	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC0751: Chaperone protein HscB	Vibrio vulnificus CMCP6 Gene: VV1_0435: Chaperone protein HscB	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_01058: Chaperone protein HscB	Vibrio parahaemolyticus RIMD 2210633 Gene: VP0599: Chaperone protein HscB	Vibrio shilonii AK1 Gene: VSAK1_12100: Chaperone protein HscB	Vibrio splendidus LGP32 Gene: VS_0610: Chaperone protein HscB	Vibrio fischeri ES114 Gene: VF_0620: Chaperone protein HscB	Vibrio salmonicida LFI1238 Gene: VSAL_I0720: Chaperone protein HscB	Vibrio angustum S14 Gene: VAS14_06698: Chaperone protein HscB	Photobacterium profundum SS9 Gene: PBPRA0753: Chaperone protein HscB	Chaperone protein HscB
hscA	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC0752: Chaperone protein HscA	Vibrio vulnificus CMCP6 Gene: VV1_0434: Chaperone protein HscA	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_01059: Chaperone protein HscA	Vibrio parahaemolyticus RIMD 2210633 Gene: VP0600: Chaperone protein HscA	Vibrio shilonii AK1 Gene: VSAK1_12095: Chaperone protein HscA	Vibrio splendidus LGP32 Gene: VS_0611: Chaperone protein HscA	Vibrio fischeri ES114 Gene: VF_0621: Chaperone protein HscA	Vibrio salmonicida LFI1238 Gene: VSAL_I0721: Chaperone protein HscA	Vibrio angustum S14 Gene: VAS14_06693: Chaperone protein HscA	Photobacterium profundum SS9 Gene: PBPRA0754: Chaperone protein HscA	Chaperone protein HscA
fdx	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC0753: ferredoxin, 2Fe-2S type, ISC system	Vibrio vulnificus CMCP6 Gene: VV1_0433: ferredoxin, 2Fe-2S type, ISC system	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_01060: ferredoxin, 2Fe-2S type, ISC system	Vibrio parahaemolyticus RIMD 2210633 Gene: VP0601: ferredoxin, 2Fe-2S type, ISC system	Vibrio shilonii AK1 Gene: VSAK1_12090: ferredoxin, 2Fe-2S type, ISC system	Vibrio splendidus LGP32 Gene: VS_0612: ferredoxin, 2Fe-2S type, ISC system	Vibrio fischeri ES114 Gene: VF_0622: ferredoxin, 2Fe-2S type, ISC system	Vibrio salmonicida LFI1238 Gene: VSAL_I0722: ferredoxin, 2Fe-2S type, ISC system	Vibrio angustum S14 Gene: VAS14_06688: ferredoxin, 2Fe-2S type, ISC system	Photobacterium profundum SS9 Gene: PBPRA0755: ferredoxin, 2Fe-2S type, ISC system	ferredoxin, 2Fe-2S type, ISC system
yfhJ	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC0754: putative Fe-S cluster assembly protein	Vibrio vulnificus CMCP6 Gene: VV1_0432: putative Fe-S cluster assembly protein	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_01061: putative Fe-S cluster assembly protein	Vibrio parahaemolyticus RIMD 2210633 Gene: VP0602: putative Fe-S cluster assembly protein	Vibrio shilonii AK1 Gene: VSAK1_12085: putative Fe-S cluster assembly protein	Vibrio splendidus LGP32 Gene: VS_0613: putative Fe-S cluster assembly protein	Vibrio fischeri ES114 Gene: VF_0623: putative Fe-S cluster assembly protein	Vibrio salmonicida LFI1238 Gene: VSAL_I0723: putative Fe-S cluster assembly protein	Vibrio angustum S14 Gene: VAS14_06683: putative Fe-S cluster assembly protein	Photobacterium profundum SS9 Gene: PBPRA0756: putative Fe-S cluster assembly protein	putative Fe-S cluster assembly protein

CRON 3.
nfuA	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -30 score = 4.58809 sequence = ATAACCTATTCTTTTACTCAGGTAT Gene: VC2720: NfuA Fe-S protein maturation	* Vibrio vulnificus CMCP6 Site: position = 9 score = 4.93791 sequence = ATAACCTACAAATTTACTCGGGTAT Gene: VV1_0864: NfuA Fe-S protein maturation	* Vibrio harveyi ATCC BAA-1116 Site: position = -30 score = 5.11056 sequence = ATAGCCTACAAATTTACTCAGGTAT Gene: VIBHAR_00614: NfuA Fe-S protein maturation	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -30 score = 4.76952 sequence = GTAACCTACAAAATTACTCAGGTAT Gene: VP0146: NfuA Fe-S protein maturation	* Vibrio shilonii AK1 Site: position = 6 score = 4.62733 sequence = ATAACCTACAACTATACTCAGGTAT Gene: VSAK1_13428: NfuA Fe-S protein maturation	Vibrio splendidus LGP32 Gene: VS_0148: NfuA Fe-S protein maturation	* Vibrio fischeri ES114 Site: position = -30 score = 4.94481 sequence = TAATCATACTAAATTAGTCAGGTAT Gene: VF_2461: NfuA Fe-S protein maturation	* Vibrio salmonicida LFI1238 Site: position = -30 score = 4.89051 sequence = TAATCATACTAATTTAGTCAGGTAT Gene: VSAL_I2911: NfuA Fe-S protein maturation	* Vibrio angustum S14 Site: position = -37 score = 5.14505 sequence = AAAACTCACTAAATAGGTCAGGTAT Gene: VAS14_21772: NfuA Fe-S protein maturation	* Photobacterium profundum SS9 Site: position = -37 score = 5.26008 sequence = AAATCTTACTAAATAGGTCAGGTAT Gene: PBPRA0177: NfuA Fe-S protein maturation	NfuA Fe-S protein maturation

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog IscR - Vibrionales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --