Regulog IscR - Vibrionales
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | activator (repressor) |
| Biological process: | Iron-sulfur cluster biogenesis |
| Effector: | Iron-sulfur cluster redox state |
| Phylum: | Proteobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Vibrionales
- By trascription factor - IscR
- By TF family - Rrf2
- By effector - Iron-sulfur cluster redox state
- By pathway - Iron-sulfur cluster biogenesis
| Genome | Genes | Operons |
|---|---|---|
| Vibrio cholerae O1 biovar eltor str. N16961 | 10 | 3 |
| Vibrio vulnificus CMCP6 | 10 | 3 |
| Vibrio harveyi ATCC BAA-1116 | 10 | 3 |
| Vibrio parahaemolyticus RIMD 2210633 | 10 | 3 |
| Vibrio shilonii AK1 | 10 | 3 |
| Vibrio splendidus LGP32 | 9 | 2 |
| Vibrio fischeri ES114 | 10 | 3 |
| Vibrio salmonicida LFI1238 | 10 | 3 |
| Vibrio angustum S14 | 10 | 3 |
| Photobacterium profundum SS9 | 10 | 3 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| erpA |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -114 score = 5.24488 sequence = ATACTTGAACGGCCAACTCAGGTAT Gene: VC0627: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Vibrio vulnificus CMCP6 Site: position = -175 score = 6.86147 sequence = ATACTTGAACGTATTGGTCAGGTAT Gene: VV1_1679: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -87 score = 6.70416 sequence = ATACTTGAACGAGTTTGTCAGGTAT Gene: VIBHAR_03416: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -103 score = 6.70416 sequence = ATACTTGAACGAGTTTGTCAGGTAT Gene: VP2474: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Vibrio shilonii AK1 Site: position = -169 score = 6.69545 sequence = ATACTTGAACGAAGCAGTCAGGTAT Gene: VSAK1_05110: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Vibrio splendidus LGP32 Site: position = -87 score = 6.82803 sequence = ATACTTGAACGTTTCAGTCAGGTAT Gene: VS_2501: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Vibrio fischeri ES114 Site: position = -75 score = 6.95769 sequence = ATACTTGAATGAAACAGTCAGGTAT Gene: VF_2134: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Vibrio salmonicida LFI1238 Site: position = -75 score = 6.95769 sequence = ATACTTGAATGAAACAGTCAGGTAT Gene: VSAL_I2571: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Vibrio angustum S14 Site: position = -68 score = 7.00705 sequence = ATACTTGAACAACATAGTCAGGTAT Gene: VAS14_07789: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Photobacterium profundum SS9 Site: position = -68 score = 7.13274 sequence = ATACTTGAACAAGTTAGTCAGGTAT Gene: PBPRA0531: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
| CRON 2. | |||||||||||
| iscR |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -23 score = 6.88847 sequence = ATACTTGACCAAAAGAGTCAAGTAT Site: position = -48 score = 6.88519 sequence = ATACCTGACTAAATTAGTCAAATAA Gene: VC0747: Iron-sulfur cluster regulator IscR |
*
Vibrio vulnificus CMCP6 Site: position = -93 score = 6.70813 sequence = ATACCTGACTATTTTAGTCAAATAA Site: position = -68 score = 7.02961 sequence = ATACTTGACCATTTTGGTCAGGTAT Gene: VV1_0439: Iron-sulfur cluster regulator IscR |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -93 score = 6.86587 sequence = ATACCTGACTAAAATAGTCAAATAA Site: position = -68 score = 6.7275 sequence = ATACTTGACCGTTTTGGTCGGGTAT Gene: VIBHAR_01054: Iron-sulfur cluster regulator IscR |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -93 score = 6.49644 sequence = ATACCTGAGTAATTTAGTCAAATAA Site: position = -68 score = 6.68394 sequence = ATACTTGACCATTTTACTCGGGTAT Gene: VP0595: Iron-sulfur cluster regulator IscR |
*
Vibrio shilonii AK1 Site: position = -91 score = 6.70813 sequence = ATACCTGACTATTTTAGTCAAATAA Site: position = -66 score = 7.04713 sequence = ATACTTGATTAAAATAGTCAGGTAT Gene: VSAK1_12120: Iron-sulfur cluster regulator IscR |
*
Vibrio splendidus LGP32 Site: position = -92 score = 6.65696 sequence = ATACCTGACTAAAATAGTCAACTAA Site: position = -67 score = 7.20203 sequence = ATACTTGACCAATTTAGTCGGGTAT Gene: VS_0606: Iron-sulfur cluster regulator IscR |
*
Vibrio fischeri ES114 Site: position = -69 score = 7.40966 sequence = ATACTTGACCAAAATAGTCAGGTAT Site: position = -94 score = 6.30175 sequence = GTACTTGACTAAAATAGTAGGATAA Gene: VF_0616: Iron-sulfur cluster regulator IscR |
*
Vibrio salmonicida LFI1238 Site: position = -69 score = 7.18734 sequence = ATACTTGACCAAAATGGTCAGGTAT Site: position = -94 score = 6.69708 sequence = ATACTTGACTAAAATAGTAGGATAA Gene: VSAL_I0716: Iron-sulfur cluster regulator IscR |
*
Vibrio angustum S14 Site: position = -103 score = 6.73401 sequence = ATACTTGACCAATTTAGTATGGTAT Site: position = -128 score = 5.82461 sequence = ATACCCTACTAGAACAGTCAGGTAA Gene: VAS14_06718: Iron-sulfur cluster regulator IscR |
*
Photobacterium profundum SS9 Site: position = -66 score = 7.07927 sequence = ATACTTGACCATTTTAGTCGGGTAT Site: position = -91 score = 6.4083 sequence = AAACCTGACTAAAATCGTCAGGTAA Gene: PBPRA0749: Iron-sulfur cluster regulator IscR |
Iron-sulfur cluster regulator IscR |
| iscS |
Gene: VC0748: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: VV1_0438: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: VIBHAR_01055: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: VP0596: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: VSAK1_12115: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: VS_0607: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: VF_0617: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: VSAL_I0717: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: VAS14_06713: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: PBPRA0750: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
| iscU |
Gene: VC0749: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: VV1_0437: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: VIBHAR_01056: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: VP0597: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: VSAK1_12110: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: VS_0608: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: VF_0618: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: VSAL_I0718: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: VAS14_06708: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: PBPRA0751: Iron-sulfur cluster assembly scaffold protein IscU |
Iron-sulfur cluster assembly scaffold protein IscU |
| iscA |
Gene: VC0750: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: VV1_0436: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: VIBHAR_01057: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: VP0598: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: VSAK1_12105: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: VS_0609: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: VF_0619: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: VSAL_I0719: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: VAS14_06703: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: PBPRA0752: Iron binding protein IscA for iron-sulfur cluster assembly |
Iron binding protein IscA for iron-sulfur cluster assembly |
| hscB |
Gene: VC0751: Chaperone protein HscB |
Gene: VV1_0435: Chaperone protein HscB |
Gene: VIBHAR_01058: Chaperone protein HscB |
Gene: VP0599: Chaperone protein HscB |
Gene: VSAK1_12100: Chaperone protein HscB |
Gene: VS_0610: Chaperone protein HscB |
Gene: VF_0620: Chaperone protein HscB |
Gene: VSAL_I0720: Chaperone protein HscB |
Gene: VAS14_06698: Chaperone protein HscB |
Gene: PBPRA0753: Chaperone protein HscB |
Chaperone protein HscB |
| hscA |
Gene: VC0752: Chaperone protein HscA |
Gene: VV1_0434: Chaperone protein HscA |
Gene: VIBHAR_01059: Chaperone protein HscA |
Gene: VP0600: Chaperone protein HscA |
Gene: VSAK1_12095: Chaperone protein HscA |
Gene: VS_0611: Chaperone protein HscA |
Gene: VF_0621: Chaperone protein HscA |
Gene: VSAL_I0721: Chaperone protein HscA |
Gene: VAS14_06693: Chaperone protein HscA |
Gene: PBPRA0754: Chaperone protein HscA |
Chaperone protein HscA |
| fdx |
Gene: VC0753: ferredoxin, 2Fe-2S type, ISC system |
Gene: VV1_0433: ferredoxin, 2Fe-2S type, ISC system |
Gene: VIBHAR_01060: ferredoxin, 2Fe-2S type, ISC system |
Gene: VP0601: ferredoxin, 2Fe-2S type, ISC system |
Gene: VSAK1_12090: ferredoxin, 2Fe-2S type, ISC system |
Gene: VS_0612: ferredoxin, 2Fe-2S type, ISC system |
Gene: VF_0622: ferredoxin, 2Fe-2S type, ISC system |
Gene: VSAL_I0722: ferredoxin, 2Fe-2S type, ISC system |
Gene: VAS14_06688: ferredoxin, 2Fe-2S type, ISC system |
Gene: PBPRA0755: ferredoxin, 2Fe-2S type, ISC system |
ferredoxin, 2Fe-2S type, ISC system |
| yfhJ |
Gene: VC0754: putative Fe-S cluster assembly protein |
Gene: VV1_0432: putative Fe-S cluster assembly protein |
Gene: VIBHAR_01061: putative Fe-S cluster assembly protein |
Gene: VP0602: putative Fe-S cluster assembly protein |
Gene: VSAK1_12085: putative Fe-S cluster assembly protein |
Gene: VS_0613: putative Fe-S cluster assembly protein |
Gene: VF_0623: putative Fe-S cluster assembly protein |
Gene: VSAL_I0723: putative Fe-S cluster assembly protein |
Gene: VAS14_06683: putative Fe-S cluster assembly protein |
Gene: PBPRA0756: putative Fe-S cluster assembly protein |
putative Fe-S cluster assembly protein |
| CRON 3. | |||||||||||
| nfuA |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -30 score = 4.58809 sequence = ATAACCTATTCTTTTACTCAGGTAT Gene: VC2720: NfuA Fe-S protein maturation |
*
Vibrio vulnificus CMCP6 Site: position = 9 score = 4.93791 sequence = ATAACCTACAAATTTACTCGGGTAT Gene: VV1_0864: NfuA Fe-S protein maturation |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -30 score = 5.11056 sequence = ATAGCCTACAAATTTACTCAGGTAT Gene: VIBHAR_00614: NfuA Fe-S protein maturation |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -30 score = 4.76952 sequence = GTAACCTACAAAATTACTCAGGTAT Gene: VP0146: NfuA Fe-S protein maturation |
*
Vibrio shilonii AK1 Site: position = 6 score = 4.62733 sequence = ATAACCTACAACTATACTCAGGTAT Gene: VSAK1_13428: NfuA Fe-S protein maturation |
Gene: VS_0148: NfuA Fe-S protein maturation |
*
Vibrio fischeri ES114 Site: position = -30 score = 4.94481 sequence = TAATCATACTAAATTAGTCAGGTAT Gene: VF_2461: NfuA Fe-S protein maturation |
*
Vibrio salmonicida LFI1238 Site: position = -30 score = 4.89051 sequence = TAATCATACTAATTTAGTCAGGTAT Gene: VSAL_I2911: NfuA Fe-S protein maturation |
*
Vibrio angustum S14 Site: position = -37 score = 5.14505 sequence = AAAACTCACTAAATAGGTCAGGTAT Gene: VAS14_21772: NfuA Fe-S protein maturation |
*
Photobacterium profundum SS9 Site: position = -37 score = 5.26008 sequence = AAATCTTACTAAATAGGTCAGGTAT Gene: PBPRA0177: NfuA Fe-S protein maturation |
NfuA Fe-S protein maturation |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |