Regulon of IscR in Vibrio splendidus LGP32

Properties
Regulator type:	Transcription factor
TF locus tag:	VS_0606
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Vibrionales
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 39 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -92 Score: 6.7 Sequence: ATACCTGACTAAAATAGTCAACTAA Position: -67 Score: 7.2 Sequence: ATACTTGACCAATTTAGTCGGGTAT Locus tag: VS_0606 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: VS_0607 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: VS_0608 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: VS_0609 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: VS_0610 Name: hscB Funciton: Chaperone protein HscB Locus tag: VS_0611 Name: hscA Funciton: Chaperone protein HscA Locus tag: VS_0612 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: VS_0613 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
	VS_0606	iscR	Iron-sulfur cluster regulator IscR
	VS_0607	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	VS_0608	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	VS_0609	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	VS_0610	hscB	Chaperone protein HscB
	VS_0611	hscA	Chaperone protein HscA
	VS_0612	fdx	ferredoxin, 2Fe-2S type, ISC system
	VS_0613	yfhJ	putative Fe-S cluster assembly protein
Position: -87 Score: 6.8 Sequence: ATACTTGAACGTTTCAGTCAGGTAT Locus tag: VS_2501 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	VS_2501	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD