Regulon of IscR in Vibrio shilonii AK1

Properties
Regulator type:	Transcription factor
TF locus tag:	VSAK1_12120
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Vibrionales
Statistics of regulated genes:
- Genes	10
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 39 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: 6 Score: 4.6 Sequence: ATAACCTACAACTATACTCAGGTAT Locus tag: VSAK1_13428 Name: nfuA Funciton: NfuA Fe-S protein maturation
	VSAK1_13428	nfuA	NfuA Fe-S protein maturation
Position: -91 Score: 6.7 Sequence: ATACCTGACTATTTTAGTCAAATAA Position: -66 Score: 7 Sequence: ATACTTGATTAAAATAGTCAGGTAT Locus tag: VSAK1_12120 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: VSAK1_12115 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: VSAK1_12110 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: VSAK1_12105 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: VSAK1_12100 Name: hscB Funciton: Chaperone protein HscB Locus tag: VSAK1_12095 Name: hscA Funciton: Chaperone protein HscA Locus tag: VSAK1_12090 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: VSAK1_12085 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
	VSAK1_12120	iscR	Iron-sulfur cluster regulator IscR
	VSAK1_12115	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	VSAK1_12110	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	VSAK1_12105	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	VSAK1_12100	hscB	Chaperone protein HscB
	VSAK1_12095	hscA	Chaperone protein HscA
	VSAK1_12090	fdx	ferredoxin, 2Fe-2S type, ISC system
	VSAK1_12085	yfhJ	putative Fe-S cluster assembly protein
Position: -169 Score: 6.7 Sequence: ATACTTGAACGAAGCAGTCAGGTAT Locus tag: VSAK1_05110 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	VSAK1_05110	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD