Regulon of IscR in Vibrio vulnificus CMCP6

Properties
Regulator type:	Transcription factor
TF locus tag:	VV1_0439
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Vibrionales
Statistics of regulated genes:
- Genes	10
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 39 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: 9 Score: 4.9 Sequence: ATAACCTACAAATTTACTCGGGTAT Locus tag: VV1_0864 Name: nfuA Funciton: NfuA Fe-S protein maturation
	VV1_0864	nfuA	NfuA Fe-S protein maturation
Position: -93 Score: 6.7 Sequence: ATACCTGACTATTTTAGTCAAATAA Position: -68 Score: 7 Sequence: ATACTTGACCATTTTGGTCAGGTAT Locus tag: VV1_0439 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: VV1_0438 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: VV1_0437 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: VV1_0436 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: VV1_0435 Name: hscB Funciton: Chaperone protein HscB Locus tag: VV1_0434 Name: hscA Funciton: Chaperone protein HscA Locus tag: VV1_0433 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: VV1_0432 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
	VV1_0439	iscR	Iron-sulfur cluster regulator IscR
	VV1_0438	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	VV1_0437	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	VV1_0436	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	VV1_0435	hscB	Chaperone protein HscB
	VV1_0434	hscA	Chaperone protein HscA
	VV1_0433	fdx	ferredoxin, 2Fe-2S type, ISC system
	VV1_0432	yfhJ	putative Fe-S cluster assembly protein
Position: -175 Score: 6.9 Sequence: ATACTTGAACGTATTGGTCAGGTAT Locus tag: VV1_1679 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	VV1_1679	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD