Regulon of IscR in Vibrio angustum S14

Properties
Regulator type:	Transcription factor
TF locus tag:	VAS14_06718
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Vibrionales
Statistics of regulated genes:
- Genes	10
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 39 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 5.1 Sequence: AAAACTCACTAAATAGGTCAGGTAT Locus tag: VAS14_21772 Name: nfuA Funciton: NfuA Fe-S protein maturation
	VAS14_21772	nfuA	NfuA Fe-S protein maturation
Position: -128 Score: 5.8 Sequence: ATACCCTACTAGAACAGTCAGGTAA Position: -103 Score: 6.7 Sequence: ATACTTGACCAATTTAGTATGGTAT Locus tag: VAS14_06718 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: VAS14_06713 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: VAS14_06708 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: VAS14_06703 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: VAS14_06698 Name: hscB Funciton: Chaperone protein HscB Locus tag: VAS14_06693 Name: hscA Funciton: Chaperone protein HscA Locus tag: VAS14_06688 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: VAS14_06683 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
	VAS14_06718	iscR	Iron-sulfur cluster regulator IscR
	VAS14_06713	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	VAS14_06708	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	VAS14_06703	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	VAS14_06698	hscB	Chaperone protein HscB
	VAS14_06693	hscA	Chaperone protein HscA
	VAS14_06688	fdx	ferredoxin, 2Fe-2S type, ISC system
	VAS14_06683	yfhJ	putative Fe-S cluster assembly protein
Position: -68 Score: 7 Sequence: ATACTTGAACAACATAGTCAGGTAT Locus tag: VAS14_07789 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	VAS14_07789	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD