Regulog Zur - Rhodobacterales

Properties
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 36 sites [see more]

Member of regulog collections

By trascription factor - Zur
By taxonomy - Rhodobacterales
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Rhodobacter sphaeroides 2.4.1	5	3
Paracoccus denitrificans PD1222	5	3
Jannaschia sp. CCS1	4	2
Rhodobacterales bacterium HTCC2654	4	2
Oceanicola granulosus HTCC2516	4	2
Loktanella vestfoldensis SKA53	4	2
Oceanicola batsensis HTCC2597	6	3
Roseovarius nubinhibens ISM	6	4
Roseovarius sp. 217	4	2
Sulfitobacter sp. EE-36	5	3
Silicibacter TM1040	6	4
Silicibacter pomeroyi DSS-3	4	2
Roseobacter sp. MED193	4	2
Hyphomonas neptunium ATCC 15444	1	1
Oceanicaulis alexandrii HTCC2633	1	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
zur	* Rhodobacter sphaeroides 2.4.1 Site: position = -24 score = 5.68874 sequence = ATTACGTTATATCATAACGCGTC Gene: RSP_3569: Zinc uptake regulation protein Zur	* Paracoccus denitrificans PD1222 Site: position = -49 score = 5.31371 sequence = TTTATGTTATATCGTAACCCGTC Gene: Pden_4139: Zinc uptake regulation protein Zur	* Jannaschia sp. CCS1 Site: position = -18 score = 5.18003 sequence = TAACTGATATGAAATAACATGAC Gene: Jann_0313: Zinc uptake regulation protein Zur	* Rhodobacterales bacterium HTCC2654 Site: position = -35 score = 5.45566 sequence = TATCTGTAATATCATAACGCATC Gene: RB2654_20873: Zinc uptake regulation protein Zur	* Oceanicola granulosus HTCC2516 Site: position = -35 score = 5.66994 sequence = GAGATGTTATAACGTAACAACCC Gene: OG2516_06067: Zinc uptake regulation protein Zur	* Loktanella vestfoldensis SKA53 Site: position = -29 score = 6.00744 sequence = GATATGTTATATCATAACAAGGC Gene: SKA53_01416: Zinc uptake regulation protein Zur	* Oceanicola batsensis HTCC2597 Site: position = -55 score = 5.26311 sequence = TTCCTGTTATAAGATAACATTGC Gene: OB2597_14481: Zinc uptake regulation protein Zur	* Roseovarius nubinhibens ISM Site: position = -54 score = 5.63892 sequence = TAGATGAGATAATATAACATATC Gene: ISM_14175: Zinc uptake regulation protein Zur	* Roseovarius sp. 217 Site: position = -98 score = 5.50582 sequence = CATATGTGATATCATAACATTCA Gene: ROS217_23042: Zinc uptake regulation protein Zur	* Sulfitobacter sp. EE-36 Site: position = -47 score = 5.48231 sequence = CACACGTTATAACATATCAACAC Gene: EE36_13033: Zinc uptake regulation protein Zur	* Silicibacter TM1040 Site: position = -86 score = 5.48256 sequence = CTGGTGTTATATCATAACGTTAT Gene: TM1040_3615: Zinc uptake regulation protein Zur	* Silicibacter pomeroyi DSS-3 Site: position = -45 score = 5.59122 sequence = GGGATGTTATAACATATCAAGCC Gene: SPO0986: Zinc uptake regulation protein Zur	* Roseobacter sp. MED193 Site: position = -111 score = 5.56808 sequence = CTCATGTAATTTTATAACATCTC Gene: MED193_01515: Zinc uptake regulation protein Zur	Hyphomonas neptunium ATCC 15444 Gene: HNE_0655: Zinc uptake regulation protein Zur	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_05994: Zinc uptake regulation protein Zur	Zinc uptake regulation protein Zur
znuC	Rhodobacter sphaeroides 2.4.1 Gene: RSP_3568: Zinc ABC transporter, ATP-binding protein ZnuC	Paracoccus denitrificans PD1222 Gene: Pden_4138: Zinc ABC transporter, ATP-binding protein ZnuC	Jannaschia sp. CCS1 Gene: Jann_0314: Zinc ABC transporter, ATP-binding protein ZnuC	Rhodobacterales bacterium HTCC2654 Gene: RB2654_20878: Zinc ABC transporter, ATP-binding protein ZnuC	Oceanicola granulosus HTCC2516 Gene: OG2516_06062: Zinc ABC transporter, ATP-binding protein ZnuC	Loktanella vestfoldensis SKA53 Gene: SKA53_01421: Zinc ABC transporter, ATP-binding protein ZnuC	Oceanicola batsensis HTCC2597 Gene: OB2597_14486: Zinc ABC transporter, ATP-binding protein ZnuC	Roseovarius nubinhibens ISM Gene: ISM_14170: Zinc ABC transporter, ATP-binding protein ZnuC	Roseovarius sp. 217 Gene: ROS217_23047: Zinc ABC transporter, ATP-binding protein ZnuC	Sulfitobacter sp. EE-36 Gene: EE36_13028: Zinc ABC transporter, ATP-binding protein ZnuC	Silicibacter TM1040 Gene: TM1040_3614: Zinc ABC transporter, ATP-binding protein ZnuC	Silicibacter pomeroyi DSS-3 Gene: SPO0985: Zinc ABC transporter, ATP-binding protein ZnuC	Roseobacter sp. MED193 Gene: MED193_01510: Zinc ABC transporter, ATP-binding protein ZnuC	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Zinc ABC transporter, ATP-binding protein ZnuC
znuB	Rhodobacter sphaeroides 2.4.1 Gene: RSP_3567: Zinc ABC transporter, inner membrane permease protein ZnuB	Paracoccus denitrificans PD1222 Gene: Pden_4137: Zinc ABC transporter, inner membrane permease protein ZnuB	Jannaschia sp. CCS1 Gene: Jann_0315: Zinc ABC transporter, inner membrane permease protein ZnuB	Rhodobacterales bacterium HTCC2654 Gene: RB2654_20883: Zinc ABC transporter, inner membrane permease protein ZnuB	Oceanicola granulosus HTCC2516 Gene: OG2516_06057: Zinc ABC transporter, inner membrane permease protein ZnuB	Loktanella vestfoldensis SKA53 Gene: SKA53_01426: Zinc ABC transporter, inner membrane permease protein ZnuB	Oceanicola batsensis HTCC2597 Gene: OB2597_14491: Zinc ABC transporter, inner membrane permease protein ZnuB	Roseovarius nubinhibens ISM Gene: ISM_14165: Zinc ABC transporter, inner membrane permease protein ZnuB	Roseovarius sp. 217 Gene: ROS217_23052: Zinc ABC transporter, inner membrane permease protein ZnuB	Sulfitobacter sp. EE-36 Gene: EE36_13023: Zinc ABC transporter, inner membrane permease protein ZnuB	Silicibacter TM1040 Gene: TM1040_3613: Zinc ABC transporter, inner membrane permease protein ZnuB	Silicibacter pomeroyi DSS-3 Gene: SPO0984: Zinc ABC transporter, inner membrane permease protein ZnuB	Roseobacter sp. MED193 Gene: MED193_01505: Zinc ABC transporter, inner membrane permease protein ZnuB	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Zinc ABC transporter, inner membrane permease protein ZnuB

CRON 2.
znuA	* Rhodobacter sphaeroides 2.4.1 Site: position = -55 score = 5.38708 sequence = GACGCGTTATGATATAACGTAAT Gene: RSP_3571: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Paracoccus denitrificans PD1222 Site: position = -83 score = 5.41792 sequence = ATGATGTTATATCGTTACATTTT Gene: Pden_4140: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Jannaschia sp. CCS1 Site: position = -61 score = 5.3734 sequence = GTCATGTTATTTCATATCAGTTA Gene: Jann_0312: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Rhodobacterales bacterium HTCC2654 Site: position = -59 score = 5.24343 sequence = GATGCGTTATGATATTACAGATA Gene: RB2654_20868: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Oceanicola granulosus HTCC2516 Site: position = -63 score = 5.08839 sequence = GGGTTGTTACGTTATAACATCTC Gene: OG2516_06072: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Loktanella vestfoldensis SKA53 Site: position = -63 score = 5.69206 sequence = GCCTTGTTATGATATAACATATC Gene: SKA53_01411: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Oceanicola batsensis HTCC2597 Site: position = -30 score = 5.20775 sequence = GCAATGTTATCTTATAACAGGAA Gene: OB2597_14476: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Roseovarius nubinhibens ISM Site: position = -115 score = 5.50557 sequence = GATATGTTATATTATCTCATCTA Gene: ISM_14180: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Roseovarius sp. 217 Site: position = -32 score = 5.28037 sequence = TGAATGTTATGATATCACATATG Gene: ROS217_23037: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Sulfitobacter sp. EE-36 Site: position = -64 score = 5.27605 sequence = GTGTTGATATGTTATAACGTGTG Gene: EE36_13038: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Silicibacter TM1040 Site: position = -36 score = 5.28632 sequence = ATAACGTTATGATATAACACCAG Gene: TM1040_3616: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Silicibacter pomeroyi DSS-3 Site: position = -65 score = 5.21105 sequence = GGCTTGATATGTTATAACATCCC Gene: SPO0987: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Roseobacter sp. MED193 Site: position = -66 score = 5.55941 sequence = GAGATGTTATAAAATTACATGAG Gene: MED193_01520: Zinc ABC transporter, periplasmic-binding protein ZnuA	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Zinc ABC transporter, periplasmic-binding protein ZnuA

CRON 3.
zinT	* Rhodobacter sphaeroides 2.4.1 Site: position = -62 score = 5.9104 sequence = GATATGTAATAACATATCATATA Gene: RSP_3117: Candidate zinc-binding lipoprotein ZinT	Paracoccus denitrificans PD1222	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597	* Roseovarius nubinhibens ISM Site: position = -34 score = 5.21682 sequence = GCTACGTTATATCATAACTACTT Gene: ISM_05645: Candidate zinc-binding lipoprotein ZinT	Roseovarius sp. 217	* Sulfitobacter sp. EE-36 Site: position = -54 score = 6.05123 sequence = GTTACGTTATAACATAACGAATC Gene: EE36_11254: Candidate zinc-binding lipoprotein ZinT	* Silicibacter TM1040 Site: position = -36 score = 5.6168 sequence = AACGTGTTATAACATAACGAATC Gene: TM1040_0201: Candidate zinc-binding lipoprotein ZinT	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Candidate zinc-binding lipoprotein ZinT

CRON 4.
trxR	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222	Jannaschia sp. CCS1 Gene: Jann_2255: Thioredoxin reductase (EC 1.8.1.9)	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53	* Oceanicola batsensis HTCC2597 Site: position = -116 score = 4.96429 sequence = GTAACGTGATATCATAACCACAT Gene: OB2597_20976: Thioredoxin reductase (EC 1.8.1.9)	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Thioredoxin reductase (EC 1.8.1.9)
yciC	Rhodobacter sphaeroides 2.4.1	* Paracoccus denitrificans PD1222 Site: position = -33 score = 5.69029 sequence = GTAACGTAATAACATTACATTTA Gene: Pden_1338: Putative zinc chaperone, COG0523 family	Jannaschia sp. CCS1 Gene: Jann_2254: Putative zinc chaperone, COG0523 family	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597 Gene: OB2597_20981: Putative zinc chaperone, COG0523 family	* Roseovarius nubinhibens ISM Site: position = -71 score = 5.40966 sequence = GTGATGTTATACTATAACAGATT Gene: ISM_00325: Putative zinc chaperone, COG0523 family	Roseovarius sp. 217	Sulfitobacter sp. EE-36	* Silicibacter TM1040 Site: position = -38 score = 5.37873 sequence = TGATTGTTATCTTATAACATTTC Gene: TM1040_0080: Putative zinc chaperone, COG0523 family	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Putative zinc chaperone, COG0523 family

CRON 5.
omr	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193	* Hyphomonas neptunium ATCC 15444 Site: position = -44 score = 5.35347 sequence = GTAATGCAATATTATTACATTAC Gene: HNE_1973: Predicted zinc-regulated TonB-dependent outer membrane transporter	* Oceanicaulis alexandrii HTCC2633 Site: position = -52 score = 5.72644 sequence = GTGACGTTATGACATTACGTAAC Gene: OA2633_05989: Predicted zinc-regulated TonB-dependent outer membrane transporter	Predicted zinc-regulated TonB-dependent outer membrane transporter

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog Zur - Rhodobacterales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --