Regulog Zur - Rhodobacterales
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Proteobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - Zur
- By taxonomy - Rhodobacterales
- By TF family - FUR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Rhodobacter sphaeroides 2.4.1 | 5 | 3 |
| Paracoccus denitrificans PD1222 | 5 | 3 |
| Jannaschia sp. CCS1 | 4 | 2 |
| Rhodobacterales bacterium HTCC2654 | 4 | 2 |
| Oceanicola granulosus HTCC2516 | 4 | 2 |
| Loktanella vestfoldensis SKA53 | 4 | 2 |
| Oceanicola batsensis HTCC2597 | 6 | 3 |
| Roseovarius nubinhibens ISM | 6 | 4 |
| Roseovarius sp. 217 | 4 | 2 |
| Sulfitobacter sp. EE-36 | 5 | 3 |
| Silicibacter TM1040 | 6 | 4 |
| Silicibacter pomeroyi DSS-3 | 4 | 2 |
| Roseobacter sp. MED193 | 4 | 2 |
| Hyphomonas neptunium ATCC 15444 | 1 | 1 |
| Oceanicaulis alexandrii HTCC2633 | 1 | 1 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| zur |
*
Rhodobacter sphaeroides 2.4.1 Site: position = -24 score = 5.68874 sequence = ATTACGTTATATCATAACGCGTC Gene: RSP_3569: Zinc uptake regulation protein Zur |
*
Paracoccus denitrificans PD1222 Site: position = -49 score = 5.31371 sequence = TTTATGTTATATCGTAACCCGTC Gene: Pden_4139: Zinc uptake regulation protein Zur |
*
Jannaschia sp. CCS1 Site: position = -18 score = 5.18003 sequence = TAACTGATATGAAATAACATGAC Gene: Jann_0313: Zinc uptake regulation protein Zur |
*
Rhodobacterales bacterium HTCC2654 Site: position = -35 score = 5.45566 sequence = TATCTGTAATATCATAACGCATC Gene: RB2654_20873: Zinc uptake regulation protein Zur |
*
Oceanicola granulosus HTCC2516 Site: position = -35 score = 5.66994 sequence = GAGATGTTATAACGTAACAACCC Gene: OG2516_06067: Zinc uptake regulation protein Zur |
*
Loktanella vestfoldensis SKA53 Site: position = -29 score = 6.00744 sequence = GATATGTTATATCATAACAAGGC Gene: SKA53_01416: Zinc uptake regulation protein Zur |
*
Oceanicola batsensis HTCC2597 Site: position = -55 score = 5.26311 sequence = TTCCTGTTATAAGATAACATTGC Gene: OB2597_14481: Zinc uptake regulation protein Zur |
*
Roseovarius nubinhibens ISM Site: position = -54 score = 5.63892 sequence = TAGATGAGATAATATAACATATC Gene: ISM_14175: Zinc uptake regulation protein Zur |
*
Roseovarius sp. 217 Site: position = -98 score = 5.50582 sequence = CATATGTGATATCATAACATTCA Gene: ROS217_23042: Zinc uptake regulation protein Zur |
*
Sulfitobacter sp. EE-36 Site: position = -47 score = 5.48231 sequence = CACACGTTATAACATATCAACAC Gene: EE36_13033: Zinc uptake regulation protein Zur |
*
Silicibacter TM1040 Site: position = -86 score = 5.48256 sequence = CTGGTGTTATATCATAACGTTAT Gene: TM1040_3615: Zinc uptake regulation protein Zur |
*
Silicibacter pomeroyi DSS-3 Site: position = -45 score = 5.59122 sequence = GGGATGTTATAACATATCAAGCC Gene: SPO0986: Zinc uptake regulation protein Zur |
*
Roseobacter sp. MED193 Site: position = -111 score = 5.56808 sequence = CTCATGTAATTTTATAACATCTC Gene: MED193_01515: Zinc uptake regulation protein Zur |
Gene: HNE_0655: Zinc uptake regulation protein Zur |
Gene: OA2633_05994: Zinc uptake regulation protein Zur |
Zinc uptake regulation protein Zur |
| znuC |
Gene: RSP_3568: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Pden_4138: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Jann_0314: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: RB2654_20878: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: OG2516_06062: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: SKA53_01421: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: OB2597_14486: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: ISM_14170: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: ROS217_23047: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: EE36_13028: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: TM1040_3614: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: SPO0985: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: MED193_01510: Zinc ABC transporter, ATP-binding protein ZnuC |
|
|
Zinc ABC transporter, ATP-binding protein ZnuC |
| znuB |
Gene: RSP_3567: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Pden_4137: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Jann_0315: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: RB2654_20883: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: OG2516_06057: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: SKA53_01426: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: OB2597_14491: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: ISM_14165: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: ROS217_23052: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: EE36_13023: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: TM1040_3613: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: SPO0984: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: MED193_01505: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
|
Zinc ABC transporter, inner membrane permease protein ZnuB |
| CRON 2. | ||||||||||||||||
| znuA |
*
Rhodobacter sphaeroides 2.4.1 Site: position = -55 score = 5.38708 sequence = GACGCGTTATGATATAACGTAAT Gene: RSP_3571: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Paracoccus denitrificans PD1222 Site: position = -83 score = 5.41792 sequence = ATGATGTTATATCGTTACATTTT Gene: Pden_4140: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Jannaschia sp. CCS1 Site: position = -61 score = 5.3734 sequence = GTCATGTTATTTCATATCAGTTA Gene: Jann_0312: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Rhodobacterales bacterium HTCC2654 Site: position = -59 score = 5.24343 sequence = GATGCGTTATGATATTACAGATA Gene: RB2654_20868: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Oceanicola granulosus HTCC2516 Site: position = -63 score = 5.08839 sequence = GGGTTGTTACGTTATAACATCTC Gene: OG2516_06072: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Loktanella vestfoldensis SKA53 Site: position = -63 score = 5.69206 sequence = GCCTTGTTATGATATAACATATC Gene: SKA53_01411: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Oceanicola batsensis HTCC2597 Site: position = -30 score = 5.20775 sequence = GCAATGTTATCTTATAACAGGAA Gene: OB2597_14476: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Roseovarius nubinhibens ISM Site: position = -115 score = 5.50557 sequence = GATATGTTATATTATCTCATCTA Gene: ISM_14180: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Roseovarius sp. 217 Site: position = -32 score = 5.28037 sequence = TGAATGTTATGATATCACATATG Gene: ROS217_23037: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Sulfitobacter sp. EE-36 Site: position = -64 score = 5.27605 sequence = GTGTTGATATGTTATAACGTGTG Gene: EE36_13038: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Silicibacter TM1040 Site: position = -36 score = 5.28632 sequence = ATAACGTTATGATATAACACCAG Gene: TM1040_3616: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Silicibacter pomeroyi DSS-3 Site: position = -65 score = 5.21105 sequence = GGCTTGATATGTTATAACATCCC Gene: SPO0987: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Roseobacter sp. MED193 Site: position = -66 score = 5.55941 sequence = GAGATGTTATAAAATTACATGAG Gene: MED193_01520: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
|
Zinc ABC transporter, periplasmic-binding protein ZnuA |
| CRON 3. | ||||||||||||||||
| zinT |
*
Rhodobacter sphaeroides 2.4.1 Site: position = -62 score = 5.9104 sequence = GATATGTAATAACATATCATATA Gene: RSP_3117: Candidate zinc-binding lipoprotein ZinT |
|
|
|
|
|
|
*
Roseovarius nubinhibens ISM Site: position = -34 score = 5.21682 sequence = GCTACGTTATATCATAACTACTT Gene: ISM_05645: Candidate zinc-binding lipoprotein ZinT |
|
*
Sulfitobacter sp. EE-36 Site: position = -54 score = 6.05123 sequence = GTTACGTTATAACATAACGAATC Gene: EE36_11254: Candidate zinc-binding lipoprotein ZinT |
*
Silicibacter TM1040 Site: position = -36 score = 5.6168 sequence = AACGTGTTATAACATAACGAATC Gene: TM1040_0201: Candidate zinc-binding lipoprotein ZinT |
|
|
|
|
Candidate zinc-binding lipoprotein ZinT |
| CRON 4. | ||||||||||||||||
| trxR |
|
|
Gene: Jann_2255: Thioredoxin reductase (EC 1.8.1.9) |
|
|
|
*
Oceanicola batsensis HTCC2597 Site: position = -116 score = 4.96429 sequence = GTAACGTGATATCATAACCACAT Gene: OB2597_20976: Thioredoxin reductase (EC 1.8.1.9) |
|
|
|
|
|
|
|
|
Thioredoxin reductase (EC 1.8.1.9) |
| yciC |
|
*
Paracoccus denitrificans PD1222 Site: position = -33 score = 5.69029 sequence = GTAACGTAATAACATTACATTTA Gene: Pden_1338: Putative zinc chaperone, COG0523 family |
Gene: Jann_2254: Putative zinc chaperone, COG0523 family |
|
|
|
Gene: OB2597_20981: Putative zinc chaperone, COG0523 family |
*
Roseovarius nubinhibens ISM Site: position = -71 score = 5.40966 sequence = GTGATGTTATACTATAACAGATT Gene: ISM_00325: Putative zinc chaperone, COG0523 family |
|
|
*
Silicibacter TM1040 Site: position = -38 score = 5.37873 sequence = TGATTGTTATCTTATAACATTTC Gene: TM1040_0080: Putative zinc chaperone, COG0523 family |
|
|
|
|
Putative zinc chaperone, COG0523 family |
| CRON 5. | ||||||||||||||||
| omr |
|
|
|
|
|
|
|
|
|
|
|
|
|
*
Hyphomonas neptunium ATCC 15444 Site: position = -44 score = 5.35347 sequence = GTAATGCAATATTATTACATTAC Gene: HNE_1973: Predicted zinc-regulated TonB-dependent outer membrane transporter |
*
Oceanicaulis alexandrii HTCC2633 Site: position = -52 score = 5.72644 sequence = GTGACGTTATGACATTACGTAAC Gene: OA2633_05989: Predicted zinc-regulated TonB-dependent outer membrane transporter |
Predicted zinc-regulated TonB-dependent outer membrane transporter |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |