Regulon of Zur in Paracoccus denitrificans PD1222

Properties
Regulator type:	Transcription factor
TF locus tag:	Pden_4139, Pden_1260
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Rhodobacterales
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 36 sites [see more]

Member of regulog collections

By trascription factor - Zur
By taxonomy - Rhodobacterales
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 5.3 Sequence: TTTATGTTATATCGTAACCCGTC Locus tag: Pden_4139 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: Pden_4138 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Pden_4137 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	Pden_4139	zur	Zinc uptake regulation protein Zur
	Pden_4138	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Pden_4137	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -33 Score: 5.7 Sequence: GTAACGTAATAACATTACATTTA Locus tag: Pden_1338 Name: yciC Funciton: Putative zinc chaperone, COG0523 family
	Pden_1338	yciC	Putative zinc chaperone, COG0523 family
Position: -83 Score: 5.4 Sequence: ATGATGTTATATCGTTACATTTT Locus tag: Pden_4140 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	Pden_4140	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD